toucan
Si le commerce extérieur était tout à coup remis en honneur en Chine, il est certain que grâce au grand nombre de ses ouvriers et au bas prix du travail, elle pourrait exporter une immense quantité de sa production industrielle. Il est également certain que ses importations n'augmenteraient pas sensiblement la masse de ses subsistances, à cause de l'étendue de son territoire et de la quantité prodigieuse de denrées qu'on y trouve. Elle ne pourrait donc échanger sa production industrielle que contre des objets de luxe, provenant de toutes les parties du monde. .

Essai sur le Principe de Population
Thomas-Robert MALTHUS


Étapes antérieures

COVID-19 fin 2020

   COVID-19 à un tournant

Hong Kong 2000-2002 (en anglais)

Premières hypothèses sur le SRAS

Ce site est protégé par Copyleft, la seule contrainte requise étant de l'indiquer comme source. On y donne des liens destinés à vous aider à retrouver d'autres informations, ainsi que des vues plus approfondies sur les sujets qui vous intéressent. Les informations importantes ne sont pas toutes en anglais ! Le chinois, principalement le Mandarin (Putonghua 普通话), est la langue parlée par le plus grand nombre de personnes dans le monde, suivie par les langues latines (français, italien, portugais, roumain, espagnol...), et enfin par l'anglais (ou peut-être certaine langues indiennes). De même, le Grec fournit la plupart des mots et concepts utilisés en science. Pour des raisons de commodité, la lingua franca de la science est l'anglais. La majeure partie de ce site est d'abord publié dans cette langue. L'enseignement généralisé du latin dans les pays de langue latine permettrait facilement, comme au cours des siècles passés, de rétablir une communication ubiquiste de bien meilleure qualité que celle imposée par un anglais mal parlé et appauvrissant la pensée.

Pour comprendre la biologie, être capable d'écrire à son propos ou d'en parler (et de comprendre ce qu'on écrit et ce qu'on dit...) quelques lectures sont utiles. Nous donnons des liens dans la Toile pour retrouver des informations importantes. Nous nous référerons à nos propres publications lorsqu'elles sont destinées à un public éclairé non spécialisé. Une page est consacrée à la génomique, mais une information plus étoffée peut être trouvée dans La Barque de Delphes publié aux Editions Odile Jacob en mai 1998, (la version en anglais du texte français a été mise à jour en 2003 et réorganisée, The Delphic Boat (Harvard University Press, Cambridge, USA), et donne une vue plus anglo-américaine de la même connaissance).

COVID-19 est sensible au climat parce que les gens tendent à se regrouper à l'intérieur quand il fait froid ou qu'il pleut : Météo à Paris

COVID-19 : Début de la vaccination 2021

Ce bloc-notes apporte des nouvelles scientifiques peu répandues. Son écriture a commencé en 2000 à Hong Kong, bien avant l'existence de ce qu'on appelle aujourd'hui maladroitement « blog » (bloc-notes en est l'équivalent français) avec le séminaire Stanislas Noria. Comme alors, le savoir présenté ici par Antoine Danchin n'entre pas en compétition avec les nouvelles d'agences de presse comme l'Agence France Presse ou Reuters. Elle sélectionne une information (souvent absente des media habituels et, pour la Chine, provenant d'informateurs avertis). Elle apporte aussi des connaissances sur l'Histoire des Sciences et la création des concepts utilisés par la biologie moderne, souvent aujourd'hui sous la forme d'une mise à jour de la génomique. Un aspect important de la nature intime de la Science a été discuté au cours d'une conférence donnée à l'Université Zhong Shan (中山大學) de Guangzhou (广州) au début des années 1990. Enfin, le rôle de la Chine est particulièrement mis en avant : le monde occidental est si puissant dans sa façon de contrôler les media que cela semble bien nécessaire. Cependant on notera que, depuis quelques années, un changement politique majeur dans l'ouverture de la Chine au monde ne permet plus d'avoir un accès fiable à l'information.

Nous ne dupliquons pas les nombreuses sources très visibles qu'on suppose accessibles au lecteur. Plusieurs sites donnent des nouvelles à propos de la grippe saisonnière A (H3N2) et de la grippe aviaire (H5N1, H7N9). Il existe aussi une carte quotidienne générale des maladies. Il faut noter que, parmi les épisodes de grippe possibles qui créeraient des ravages, il y a les épidémies de grippe, notamment liées au sérotype H2, H2N2 en particulier, qui pourraient être beaucoup plus meurtrières. Espérons que, contrairement au SRAS, l'épidémie actuelle aura servi de leçon.

Par ailleurs le bloc-notes de Crawford Kilian s'est désormais étendu à toutes sortes d'autres maladies et surveille la Toile avec soin. Le Center for Infectious Disease Research Policy (CIDRAP) de l'Université du Minnesota, et le site de l'Organisation Mondiale de la Santé (OMS) sont des sources d'information prioritaires. L'information circule aujourd'hui très rapidement, et nous ne donnons donc ici que des compléments. Pour les grippes H7N9, H9N2, H5N1 et désormais surtout H3N8 les données sont accessibles directement à notre page en anglais (lorsqu'il y a lieu d'en parler) et au centre de surveillance de Hong Kong.

Mise à jour continue de l'infection par le 2019-nCoV (via le CCSE de l'Université Johns Hopkins)

Dans le cas de l'épidémie COVID-19, notez que les chiffres sont donnés à titre purement indicatif et changent rapidement.

mobile-arrow Mise à jour quotidienne générale
mobile-arrow Analyse de la mortalité

mobile-arrow Prévisions du nombre des cas

Comme une information pertinente est désormais largement représentée, les notes ici proposées traitent uniquement de questions plus rarement posées.

Pour détailler les nouvelles quotidiennes, cliquer sur les triangles,ou cliquer sur "Toutes les nouvelles ". Pour revenir en arrière aller à la page d'accueil, ou au plan du site.

Publications à usage du public général

Toutes les nouvelles | Titres seuls

arrow 2 Octobre 2021. Attention à la mutagenèse : le molnupiravir est à la fois mutagène et cancérigène.
L'effet positif du molnupiravir sur le développement de la COVID-19 est fortement médiatisé. Il est important de rappeler que les dérivés N-hydroxylés de la cytosine sont hautement mutagènes s'ils entrent dans le pool de nucléotides phosphorylés. On s'attend à ce que cela provoque effectivement une mutation rapide du SARS-CoV-2, entraînant un affaiblissement de sa descendance, mais la même cause interférera également avec la synthèse de l'ADN de l'hôte, via la réduction probable du diphosphate de la base modifiée en un analogue désoxyribo. La base est en effet en équilibre avec une forme tautomérique qui lie le A au lieu du G.

molnupiravir

Si le médicament est utilisé chez des personnes très âgées qui vont probablement mourir bientôt, cela ne présente pas trop d'inconvénients. En revanche, s'il est utilisé chez des personnes jeunes, il peut augmenter significativement leur risque de développer un cancer après quelques années.
arrow 20 Septembre 2021. Le domaine de liaison aux récepteurs des virus de chauve-souris découverts au Laos est le plus proche des ancêtres connus de la souche pandémique.
Des chercheurs de l'Institut Pasteur du Laos, fondé par le Pr Paul Brey et bénéficiant d'un soutien limité de l'Institut Pasteur de Paris, et l'Université nationale du Laos ont collecté des échantillons dans ce pays d'Asie du Sud-Est pendant six mois à partir de juillet de l'année dernière. Ils ont découvert que la séquence du domaine de liaison au récepteur de la protéine spicule présente des caractéristiques qui manquent chez le RatG13, parent le plus proche du SRAS-CoV-2. Cependant, le reste du génome du virus est plus éloigné de la souche épidémique. Cela plaide en faveur d'événements impliquant une recombinaison entre différentes souches virales. Ce type d'événement peut aussi bien être apparu dans la nature que dans un laboratoire.
arrow 12 Septembre 2021 . Les données statistiques identifient tous les décès causés par la COVID-19 aux États-Unis.
Le Centre national des statistiques sanitaires des États-Unis a publié les résultats de la surveillance de la mortalité due aux maladies pulmonaires depuis 2017. covid real
Cela permet de comparer les décès causés récemment par la grippe, ainsi que les décès directement attribués à la COVID-19. La lignes rouge indique que tous les décès causés par les maladies pulmonaires sont souvent significativement en plus grand nombre que les décès directement attribués à la pandémie, ce qui démontre que le comptage officiel des décès comme dus à laz COVID-19 est sous-évalué même dans un pays aussi développé que les USA.
arrow 8 Septembre 2021. La propagation de la COVID-19 est extrêmement contrastée.
Jusqu'à présent, le nombre total de personnes touchées par le COVID-19 semble diminuer dans le monde. Cependant, certaines régions, comme Singapour, connaissent une forte augmentation du nombre de cas : 347 nouveaux cas locaux de Covid-19, chiffre qui n'y a pas été atteint depuis août 2020. D'autres pays, comme la Suède et le Japon, sont sur le point d'assouplir les règles pour contenir l'épidémie. La Chine maintient sa politique de zéro Covid, avec 14 jours de quarantaine obligatoire même pour les personnes entièrement vaccinées venant de l'étranger.
arrow 3 Septembre 2021. L'étude de l'origine du virus de la grippe H1N1 lors de l'épidémie de 2009 devrait permettre de tirer des leçons quant à l'origine de l'épidémie actuelle de COVID-19.
En 2009, une épidémie sérieuse causée par un variant du virus de la grippe H1N1 a commencé aux États-Unis. Très tôt, on a pensé que l'origine du variant se trouvait en Chine, comme l'ont rapporté des scientifiques de Hong Kong. Il a fallu beaucoup de temps aux chercheurs américains pour découvrir que le virus était en fait originaire du Mexique, après avoir réassorti plusieurs de ses huit morceaux de génome avec des virus d'Europe et d'Asie. La clé du réassort était que plusieurs virus pouvaient se trouver ensemble dans des élevages de porcs. Des personnes ont été infectées par les porcs, et les porcs ont infecté d'autres personnes, dans différents centres d'élevage à travers le monde, ce qui a permis la présence de plusieurs virus différents au sein d'un même élevage. La structure actuelle du génome du SRAS-CoV-2 indique clairement une origine chez les chauves-souris, mais le passage à l'homme nécessiterait la présence simultanée de plusieurs virus dans un environnement peuplé de nombreux hôtes intermédiaires possibles. Les situations dans lesquelles cela pourrait se produire ne sont pas si nombreuses et les élevages denses d'animaux, en particulier s'ils ont pu être en contact avec des chauves-souris ou des personnes manipulant les chauves souris devraient être ciblés en premier lieu comme candidats possible pour tenter d'identifier les parents du virus.
arrow 24 août 2021. Le modèle  « signal de danger » de la réponse immunitaire est justifié : il explique pourquoi les enfants sont généralement atteints d'une forme bénigne de COVID-19.
Immédiatement après la naissance, tous les nouveau-nés sont confrontés à un contact permanent avec une agression respiratoire. Leur système respiratoire, qui descend du nez jusqu'au fond des poumons, doit être en alerte permanente pour réagir à tout pathogène entrant. Polly Matzinger a proposé que les membranes cellulaires lésées libèrent des composants qui signalent un danger et que, très tôt au cours de l'évolution, les cellules étaient préparées à réagir en mettant en place une réponse protectrice, via un réseau de cellules et de molécules spécialisées. Ce " modèle du danger " est à l'origine du système immunitaire. En comparant le niveau d'expression des gènes dans les cellules nasales d'enfants et d'adultes, Irina Lehmann et ses collègues, à l'hôpital de la Charité à Berlin, ont maintenant montré que les récepteurs de reconnaissance de signaux d'infection des cellules nasales sont exprimés à un niveau moyen constant chez les enfants, contrairement à la situation chez les adultes. Cela permet aux enfants de réagir immédiatement à l'infection virale.
arrow 12 Août 2021. Une conséquence inattendue de la manipulation du génome par CRISPR : la « chromothripsie ».
Un groupe de chercheurs américains a observé que, dans une petite proportion de la descendance de cellules animales qui avaient été modifiées à l'aide des techniques CRISPR de réécriture du génome, les chromosomes avaient été réarrangés en fragments collés les uns aux autres plus ou moins au hasard (mise en garde : ce travail est publié dans la revue Nature, donc à prendre avec des pincettes). Cette destruction de la structure des chromosomes (il faut féliciter les auteurs d'avoir inventé un néologisme en respectant les règles de la nomenclature scientifique) est généralement léthale pour les cellules, mais certaines survivent et ne sont plus capables de se multiplier de manière contrôlée, générant des tumeurs. Comprendre cet événement est essentiel pour les développements futurs de la technique si elle est appliquée à la thérapie génique, par exemple. L'Australie et la Chine s'efforcent de mettre en œuvre leur politique du "zéro COVID". Plus de 70 000 membres du parti ont été envoyés pour aider les villes en Chine, alors que davantage de personnel militaire est déployé en Australie. Un membre très en vue des Centres chinois de contrôle des maladies infectieuses affirme que la seule solution est la vaccination massive, et qu'une politique de zéro COVID sera impossible à maintenir à long terme.
arrow 30 Juillet 2021. La stratégie du " zéro COVID " est quasiment impossible à mettre en œuvre.
Alors que l'épisode de Nanjing s'est étendu à de multiples provinces chinoises, l'Australie envoie son armée pour imposer un confinement strict à Sydney. C'est intéressant car le même objectif est choisi par deux systèmes politiques diamétralement opposés. Nous pouvons prédire sans risque que le " zéro COVID " ne réussira pas. Si cela était possible au début de la maladie, c'est désormais un fantasme. La seule issue est la vaccination, associée à une recherche continue pour créer des vaccins qui s'adaptent en permanence à l'évolution du virus. L'autre solution, la découverte d'antiviraux efficaces, permettrait d'égaler le succès des antibiotiques, mais, comme les virus dépendent entièrement de leurs cellules hôtes, c'est probablement aussi difficile que de guérir le cancer. En tout état de cause, les vaccins et les antiviraux devraient aller de pair, tout comme les vaccins et les antibiotiques
.
arrow 27 Juillet 2021. Un important foyer de variant delta du SARS-CoV-2 touche Nanjing en Chine.
Il sera intéressant de voir comment ce foyer - 106 cas à l'heure actuelle - évolue alors que la Chine tente toujours de mettre en œuvre une politique de " zéro COVID ". Ce foyer épidémique a été déclenché par des nettoyeurs de cabine d'avion, asymptomatiques, et s'est rapidement étendu. Les personnes ayant transité par l'aéroport de Nanjing propagent le virus dans plusieurs provinces. Dong Yan Jin, de l'Université de Hong Kong, suggère que les personnes les plus exposées, comme le personnel médical et aéroportuaire, reçoivent une troisième injection de vaccin, car cela induit une réponse immunitaire très forte et empêche la contamination
.
arrow 21 Juillet 2021. Les personnes qui refusent d'être vaccinées sort coupables d'homicide par imprudence. Elles devraient être sévèrement condamnées comme telles.
La vaccination est connue depuis plus de deux siècles comme un moyen efficace d'arrêter la propagation des épidémies. Elle a permis à l'humanité de se débarrasser de la variole et, récemment, de la poliomyélite. Elle permet aussi d'éviter des millions de morts prématurées et les séquelles dangereuses de nombreuses maladies. Il n'y a aucune excuse pour refuser de se faire vacciner contre le SRAS-CoV-2. En fait, la poussée actuelle de la pandémie aurait pu être contenue si davantage de personnes avaient été vaccinées. En outre, le fait même qu'il y ait un grand nombre de personnes non vaccinées fait que le virus continue à multiplier les variants, dont beaucoup sont et seront des variants dangereux. S'ils apparaissent, touchant en particulier les jeunes, ce sera la conséquence du comportement irresponsable de ceux qui refusent la vaccination, ainsi que des gouvernements qui n'imposent pas une politique de vaccination obligatoire
.
arrow 6 Juillet 2021. Le variant Lambda du SARS-CoV-2 a atteint l'Australie.
Originaire du Pérou en décembre 2020, ce variant est désormais à l'origine de plus de 80 % des infections à COVID-19 dans ce pays. Il est aussi répandu au Chili, en Équateur et en Argentine. Il porte une mutation dans la protéine spicule appelée L452Q, semblable à la mutation L452R observée dans les variants Delta et Epsilon. Ce variant est préoccupant non seulement parce qu'il se propage rapidement, mais aussi parce qu'il pourrait être plus résistant aux vaccins
.
arrow 2 Juillet 2021. Des expériences dangereuses de gain de fonction continuent à être développées avec des virus hautement pathogènes.
Charles Perrow, dans son ouvrage Normal Accidents, a démontré de manière frappante le caractère inévitable des accidents dans le développement des technologies avancées. Les virus sont particulièrement susceptibles de se propager dans les laboratoires et de se répandre dans la population. C'est pourquoi des règles de confinement extrême, telles que les laboratoires BSL-4, ont été créées. Pourtant, avant d'être confiné dans de tels locaux, un virus doit avoir été reconnu comme appartenant aux microbes et toxines hautement pathogènes soumis à autorisation de détention et de manipulation par la règlementation (MOTs). Ce n'est pas le cas du SARS-CoV-2, par exemple (et, de fait, il est libre dans la nature, comme on le constate, notamment avec la propagation du variant delta). Certains virus de la grippe font partie de cette liste, mais la plupart des expériences sont développées avec des règles de confinement limitées. En particulier, tant pour le SARS que pour les virus de la grippe, des expériences de « gain de fonction » ont été et sont encore réalisées régulièrement. Cela signifie que les chercheurs utilisent un virus qui infecte les animaux d'une espèce donnée, pour voir comment il pourrait évoluer et infecter une autre espèce, homme compris ! Une expérience récente de ce type a étudié comment le virus de la grippe H10N7 pourrait se propager entre mammifères. Ce virus infecte les phoques, et les auteurs de l'étude ont montré comment il pouvait se propager aux furets (modèle systématiquement utilisé pour imiter les infections humaines) par voie aérienne. De façon remarquable, cette étude a montré que les mutations qui modifiaient la spécificité de l'hôte étaient les mêmes que celles qu'on trouve dans le variant H2 hautement pathogène de la grippe. Outre la mise en œuvre très controversée de cette famille d'expériences, cela démontre deux choses : 1/ qu'il existe de multiples chemins pour aller vers des formes du virus de type H2, et cela indique qu'il faut surveiller avec une extrême attention l'éventuelle résurgence de la grippe H2N2, pour laquelle seule la partie la plus âgée de l'humanité pourrait encore avoir des anticorps (on peut prédire que ses conséquences seront catastrophiques, notamment pour les jeunes), et 2/ qu'il faut surveiller les virus de la grippe qui se sont déjà répandus chez les mammifères. C'est le cas du virus de la grippe canine H3N8, qui infecte aussi les chevaux et les phoques, ce qui laisse penser qu'il n'est qu'à quelques pas d'infecter l'homme. Malheureusement, le public semble devenir amnésiques chaque fois qu'une épidémie disparaît, et ne se prépare jamais à l'avenir... 
arrow 25 Juin 2021. Vous vous interrogez sur les accidents de laboratoire ? Visitez les laboratoires de microbiologie et constatez par vous-même ce qu'il en est.
La mise en œuvre des règles de biosécurité est obligatoire. Pourtant, sont-elles appliquées ? Il suffit de visiter un laboratoire de microbiologie et de voir combien de scientifiques, d'ingénieurs et de techniciens portent une blouse, pour comprendre combien la situation est catastrophique. Avec la dictature actuelle de l'ego, il n'est pas difficile de voir que les gens font ce qu'ils veulent, et non ce qu'ils devraient faire. Ce comportement très malheureux est un fléau dans le monde entier et démontre l'incompréhension totale d'un nombre considérable de personnels de laboratoire, surtout dans les milieux universitaires (dans l'industrie, en raison des normes imposées par les assurances, avec des conséquences financières importantes en cas de manquement, le respect de la biosécurité est bien meilleur). L'incompréhension de la nature profonde de la liberté, qui se soucie de ce qui arrive aux autres plutôt que de l'ego omniprésent, est aussi la cause majeure du ralentissement de la vaccination. L'avenir est sombre.
arrow 14 Juin 2021. L'épidémie est en route pour une nouvelle vague au Royaume-Uni.
La variant delta a gagné du terrain au Royaume-Uni, déclenchant une nouvelle vague de la maladie.
UK delta
Malgré un excellent niveau de vaccination, le Royaume-Uni est en passe de connaître une nouvelle vague de COVID-19. En effet, sa transmission est nettement plus élevée que celle des variants précédents, avec pour conséquence que l'immunité collective exigera qu'au moins 80 % de la population soit vaccinée avant que la maladie ne puisse être maîtrisée. La vaccination devrait être rendue obligatoire.
arrow 13 Juin 2021. Le variant delta du SARS-CoV-2 est sur le point de se propager dans le monde entier et de déclencher une nouvelle vague de COVID-19.
Le variant delta, en provenance d'Inde, progresse au Royaume-Uni.
variant delta
Il est à la fois plus transmissible et peut sans doute causer une maladie plus grave. Sa propagation doit être contenue autant que possible par l'amélioration de la campagne de vaccination.
arrow 10 Juin 2021. Les moustiques Aedes egypti  infectés par la bactérie intracellulaire Wolbachia suppriment la propagation de la dengue.
Un essai réalisé à Yogyakarta, en Indonésie, a démontré que les secteurs où le moustique
Aedes egypti de type sauvage était présent conduisaient à beaucoup plus de cas de dengue que les secteurs où le moustique relâché avait été infecté par la bactérie Wolbachia, qu'il transmet efficacement à sa progéniture. Ces résultats font espérer contrôler et peut-être éradiquer la dengue dans les nombreuses régions où la maladie est actuellement sur une pente explosive.
arrow 5 Juin 2021. En attendant l'acceptation par une revue à comité de lecture, la dernière inconnue du génome humain a enfin été séquencée par le Consortium « Telomere 2 Telomere ».
Si l'on a longtemps dit connaître la séquence complète du génome humain, il restait encore 8% de séquences inconnues. Grâce aux techniques permettant des lectures longues (PacBio et Oxford Nanopore), c'est désormais chose faite. En utilisant une tumeur embryonnaire présentant une contrepartie exacte d'une duplication des 23 chromosomes d'un organisme humain, il a été possible de séquencer des régions hautement répétées telles que celles des centromères des chromosomes, des faisceaux d'ADN qui maintiennent les chromosomes ensemble et jouent un rôle clé dans la division cellulaire. Comme ces séquences sont très répétées, elles ne codent généralement pas pour des gènes de protéines. Pourtant, cela a permis d'identifier environ 80 nouveaux gènes, dont la fonction reste pour l'instant inconnue.

arrow 1 Juin 2021. Une étude développée par l'Institut Butantã de São Paulo établit l'immunité de groupe lorsque la population est vaccinée à l'aide du vaccin chinois Coronavac.
L'étude, qui a débuté il y a 40 jours dans la petite ville de Serrana (45 000 habitants), montre que lorsque 75 % de la population a été vaccinée à l'aide du principal vaccin de Sinovac contre le SRAS-CoV-2, l'épidémie de COVID-19 cesse de se développer..
arrow 29 Mai 2021. Les autorités sanitaires du Vietnam ont identifié un nouveau variant du SARS-CoV-2 qui se propage très rapidement.
Ce variant semble être un hybride combinant les variants du Royaume-Uni et de l'Inde. Ce n'est pas inattendu, car la sélection naturelle favorise la propagation du virus. Toutefois, sa pathogénicité n'est pas établie à ce stade. S'il est moins dangereux que ses parents, il pourrait se diffuser très vite et agir comme un vaccin naturel, comme cela s'est produit précédemment chez les animaux avec divers coronavirus.
arrow 23 Mai 2021. Les patients atteints de COVID-19 traités par stéroïdes risquent d'attraper des infections secondaires dangereuses.
Le grand nombre de patients en Inde, permet d'observer certaines tendances inquiétantes lorsque les patients commencent à se remettre de la COVID-19. En particulier, les patients traités aux stéroïdes risquent de contracter la mucormycose, une infection causée par un champignon banal mais très dangereux en cas d'immunodépression, du genre Mucor (champignon "poils de chat"). L'Inde a déjà enregistré plus de 9000 cas de cette infection avec un taux de mortalité de 50%.
arrow 16 Mai 2021. Parmi les nombreuses erreurs commises par l'OMS et à l'origine de la pandémie figure la méconnaissance du rôle des aérosols.
Le 30 avril, l'OMS a mis à jour subrepticement une page de son site web. Le magazine Wired rapporte que dans la section décrivant la transmission du coronavirus—ceux qui ne lisent pas l'anglais peuvent utiliser les logiciels de traduction automatique comme DeepL pour en avoir la teneur—, le texte indique désormais que le virus peut se propager par des aérosols ainsi que par des gouttelettes plus grosses. Il était facile de passer à côté de ce changement majeur dont l'importance a un rôle considérable dans la propagation de l'épidémie. Cette défaillance, non signalée par les ministères et agences concernés, plaide pour des changements majeurs au niveau des autorités sanitaires, dans le monde entier. Les autorités de Singapour, confrontées à une soudaine résurgence de la maladie, notent que le variant indien, B.1.617, pourrait avoir une plus grande propension à affecter les enfants et peut-être les jeunes gens que les souches originales. Elles ont décidé de fermer les écoles.
arrow 15 Mai 2021. Il n'y a aucune justification scientifique aux expériences de « gain de fonction ».
Il y a vingt ans, nous nous sommes opposés à l'idée de séquencer le génome du virus de la variole. Nous soutenions que les connaissances correspondantes n'avaient aucune valeur pour le bien commun. En fait, ce type de connaissance a déclenché des expériences de « gain de fonction » où un pathogène bénin peut être transformé en un pathogène très dangereux. Pour des raisons qui n'ont aucune valeur morale, les scientifiques du monde entier ont continué à développer ce type d'expériences, et il y a maintenant des raisons de soupçonner que ces tentatives dangereuses ont été développées à l'Institut de Virologie de Wuhan, financé non seulement par la Chine, mais aussi par les États-Unis et d'autres pays. Il est catastrophique qu'un certain nombre d'expériences appartenant à cette famille d'approches d'évolution forcée continuent d'être développées.
arrow 8 Mai 2021. Les politiques publiques imposant des règles pour le bien commun sont beaucoup plus efficaces que la politique du laisser faire.
Il est plus que temps d'évaluer les conséquences des politiques publiques à l'heure où la majorité des pays touchés par la maladie préfèrent encore vivre avec la COVID-19 plutôt que de la combattre sérieusement. Une publication parue dans The Lancet met en lumière les conséquences de diverses politiques pour contrôler la maladie. Selon tous les critères (y compris la durée de restriction des libertés publiques), il semble que l'objectif "zéro COVID" soit de loin la politique la plus efficace, non seulement en termes de reprise économique mais aussi en termes de durée de restriction des libertés. Une fois de plus, suivre la dictature malheureusement très répandue de l'« ego » universel qui prévaut dans la majeure partie du monde, règle qui tend à laisser les gens faire ce qu'ils veulent, a des conséquences gravement négatives pour tout le monde. Contrôler le développement de la COVID-19 dès son apparition (avec des règles d'isolement strictes et imposant des sanctions très sérieuses lorsque l'on ne s'y conformte pas) est extrêmement efficace car cela permet un retour rapide à la normale, tant en termes économiques qu'en termes de liberté.

mortality
On remarque toujours un excès de mortalité à ce jour en France.
arrow 5 Mai 2021. Le caractère saisonnier de la COVID-19, comme de la grippe, semble se confirmer.
Diverses études ont suggéré que la COVID-19, comme d'autres maladies respiratoires, est probablement saisonnière. Cela donne de l'espoir pour les prochains mois (à condition que la vaccination soit bien appliquée). Parmi les différents facteurs impliqués, notamment la température, l'humidité et les UV, seul ce dernier semble avoir un réel effet, pour des raisons qui ne sont pas totalement claires. Il est toutefois important de rappeler que lorsque la température est basse, les gens ont tendance à se regrouper dans des espaces confinés, ce qui constitue la source de contamination la plus évidente. L'explosion démographique est donc une cause majeure d'épidémies dangereuses. A cet égard, et contrairement à la position "nataliste" défendue un peu partout, la Chine sera probablement la première à résoudre le problème. C'est une fiction d'affirmer qu'un pays rempli de jeunes gens survivra mieux qu'un homologue avec une population vieillissante : les premières décennies de la vie sont aussi coûteuses pour l'économie que les dernières, et si la jeunesse est effectivement innovante, elle ne peut l'être que si la mémoire de ce qui a été établi précédemment est préservée. C'est pourquoi des civilisations très évoluées ont soudainement disparu, et qu'il a fallu des siècles pour retrouver ce qui était connu auparavant. L'innovation peut toujours réinventer la roue.
arrow 30 Avril 2021. Les accidents extrêmement rares liés à la vaccination ne doivent pas être utilisés contre ce moyen essentiel de contrôler l'épidémie de COVID-19.
Toutes les pratiques humaines comportent un certain niveau de risque. Les accidents domestiques, par exemple, sont malheureusement fréquents et nous savons tous que conduire une voiture peut être mortel. Pourtant, nous ne nous privons pas d'utiliser ce moyen de transport. Dans le cas de la vaccination, qui implique l'injection d'une entité étrangère dans le corps, on s'attend à ce que, pour certaines personnes, cela déclenche une réaction indésirable, exceptionnellement même mortelle. En revanche, cela permettra de protéger les personnes et d'éviter les conséquences souvent désastreuses de la COVID-19. Il est donc essentiel de comparer les avantages de la vaccination aux risques auxquels les personnes sont exposées lorsqu'elles ne sont pas vaccinées. Une étude portant sur plus de 600 000 personnes au Royaume-Uni a mesuré les effets indésirables de deux vaccins, le vaccin BioNTech/Pfizer et le vaccin AstraZeneca. Le résultat de cette analyse est important : les effets secondaires sont généralement peu préoccupants et les accidents liés aux vaccins sont extrêmement rares, de sorte que la vaccination présente un avantage considérable pour la population. Une observation doit cependant être suivie de près au fur et à mesure de l'évolution de l'épidémie : les personnes ayant déjà été atteintes par la COVID-19 étaient trois fois plus susceptibles que les autres de présenter des effets secondaires systémiques après la première dose de BioNTech/Pfizer, presque deux fois plus après une dose d'AstraZeneca, et étaient plus susceptibles de signaler des effets secondaires locaux. Cela indique qu'à l'avenir, certains variants du virus pourraient déclencher des réponses paradoxales, les infections antérieures (et éventuellement la vaccination) entraînant une sensibilisation parallèlement à une altération de la protection. Il est néanmoins essentiel de comprendre que le bien commun doit prévaloir sur les intérêts individuels, contrairement à la dictature de l'ego qui prévaut actuellement dans le monde occidental.
arrow 28 Avril 2021. Autre perspective : le taux de mortalité en France est dix fois pire qu'en Inde.
À l'heure actuelle, les chiffres officiels des autorités sanitaires indiennes comptent 147 décès dus au COVID-19 par million de citoyens. Le chiffre en France est de 1 584 par million. Cependant, il y a une forte augmentation en Inde, alors que la courbe est plate en France, mais cela laisse le temps à l'Inde de parvenir à des chiffres aussi mauvais que ceux de la France. Parallèlement, le Canada a développé un excellent système pour identifier les nouveaux variants du virus, avec un système central de notification des séquences du SRAS-CoV-2. Il est important de souligner le fait que, par principe, toutes les séquences nucléotidiques devraient être transmises à l'International Nucleotide Sequence Database Collaboration (DDBJ/ENA-EBI/GenBank), mais que, pour des raisons obscures et inavouables, de nombreux virologistes ne respectent pas cette exigence. En France, les autorités ineptes qui ont soutenu les remèdes de charlatans ratés sont totalement incapables de suivre ce qui se passe. Malheureusement, cela n'a rien à voir avec les orientations politiques, car le personnel politique de ce pays, de gauche, du centre et de droite, est totalement ignare sur le plan scientifique. Cela implique, hélas, que la France disparaîtra bientôt des pays importants et verra son système de santé s'effondrer.
arrow 20 Avril 2021. COVID-19 en perspective.
Alors que la maladie a tué plus de trois millions de personnes, il faut noter que la tuberculose continue à en tuer plus de 1,5 millions chaque année.

arrow 13 April 2021. Un petit pic de mortalité en Europe touchant des personnes de moins de 45 ans est préoccupant.
Au Brésil, la moitié des personnes gravement atteintes ont moins de 45 ans. Un petit pic en Europe révèle une tendance similaire, qui montre que la maladie doit être prise très au sérieux par les jeunes.
pandemic
Des statistiques Européennes montrent que le nombre de décès - vraisemblablement causés en majorité par des accidents - en dessous de 15 ans est inférieur à la normale. En revanche, un pic significatif entre 15 et 44 ans doit être sérieusement analysé car il peut révéler un tournant dans la pathogénicité du virus (d'autres causes, comme les suicides, ne doivent cependant pas être écartées). La ligne bleue pointillée indique le nombre normal, tandis que les cas au-dessus de la ligne rouge sont statistiquement significatifs.
arrow 11 Avril 2021. L'explosion démographique actuelle est bien plus inquiétante que la COVID-19.
Notre planète est aujourd'hui occupée par 6 milliards de personnes de plus qu'il y a un siècle. Cette situation n'est pas viable, même à court terme. C'est tellement évident qu'il semble que la grande majorité d'entre nous soit complètement aveugle aux moments difficiles qui nous attendent.
pandemic
L'épidémie actuelle devrait nous donner l'occasion de comprendre que cela doit être pris au sérieux : il suffit de penser au nombre de doses de vaccin nécessaires pour contrôler la propagation du SRAS-CoV-2 et de ses inévitables variants. Pensez aussi aux prochaines épidémies, qui seront beaucoup plus graves. Pourtant, personne ne semble s'en soucier et il semble littéralement obscène de faire allusion à la bombe démographique
.
arrow 9 Avril 2021. Nouvelle confirmation du caractère social de nos maladies.
L'
Office fédéral de la santé publique en Suisse a collecté des informations sur les maladies contagieuses depuis l'épidémie de COVID-19 en les comparant à la période précédente. En pratique, la rougeole a pratiquement disparu: 4 cas contre 149 l'année d'avant (et encore aucun en 2021). La même situation prévaut en France avec 240 cas contre 2636 en 2019. De même il n'y a eu que 117 cas de grippe en Suisse contre 12,441 cas les 52 semaines précédentes. La même tendance a été observée pour les maladies respiratoires à cause bactérienne.
arrow 7 Avril 2021. La gestion de l'épidémie diffère considérablement d'un pays européen à l'autre.
Certains pays ont tiré la leçon de leur mauvaise gestion initiale et ont considérablement amélioré la façon dont ils abordent l'épidémie..
pandemic
Mais le contraste avec d'autres est considérable. Nous proposons quelques idées pour anticiper le futur de l'épidémie (en anglais).
arrow 28 Mars 2021. L'Organisation Mondiale de la Santé n'a pas encore publié son rapport sur l'origine de la COVID-19.
Bien que l'équipe de l'OMS soit revenue de Chine depuis longtemps, elle n'a pas publié le rapport complet de ses conclusions. Dans ces conditions, le fait même que Peter Daszak fasse partie de l'équipe est malvenu, car il était membre d'un organisme qui soutenait la recherche, financièrement et scientifiquement, à l'Institut de virologie de Wuhan, ce qui constitue un conflit d'intérêts évident. La question posée est celle de l'écart entre la séquence du génome des virus apparentés à la chauve-souris, en particulier RaTG13 et la séquence du SARS-CoV-2. Dans ce dernier, il existe une séquence insérée très surprenante qui a permis au virus de pénétrer facilement dans les cellules humaines via son récepteur ACE-2. Cela implique une recombinaison avec un autre virus, soit accidentelle (par exemple via une co-infection avec des virus de la même famille, trouvée récemment en Asie du Sud-Est), soit construite en laboratoire dans ces expériences de "gain de fonction" qui sont très à la mode depuis quelques années, se retrouvant dans des revues populaires comme Nature ou Science, ce qui plait beaucoup aux chercheurs ambitieux. Un accident de laboratoire ne peut être exclu à ce stade, en particulier à Wuhan. La propagation de la maladie s'accélère à nouveau. On pouvait s'y attendre très tôt. Il faut aussi savoir maintenant qu'elle va devenir endémique, nécessitant des changements fréquents de vaccins, à moins de découvrir des molécules antivirales efficaces.
arrow 21 Mars 2021. Nos maladies sont des maladies sociales.
Il y a un mois, nous pouvions espérer le meilleur, mais cela supposait que nous nous soyons préparés au pire. Ce n'est pas le cas, et l'épidémie repart de plus belle. Sur une planète en proie aux conséquences de l'explosion démographique humaine, il serait nécessaire de s'abstenir de tout rassemblement grégaire. Malheureusement, pour toutes sortes de raisons, les gens continuent à oublier de respecter des distances raisonnables, et le virus se propage..
pandemic

Il est maintenant plus qu'urgent de suivre les variations du virus, afin de pouvoir identifier les endroits où il s'est atténué. Malheureusement, il semble difficile d'obtenir un accès correct aux séquences du génome viral et les informations ne sont pas correctement partagées.
arrow 18 Mars 2021. La France persiste à ne pas gérer correctement la COVID-19.
L'Institut Lowy nous offre un triste tableau de la façon calamiteuse dont le gouvernement français gère la maladie. Le parallèle avec la destruction de l'enseignement depuis le milieu des années 1970 et la quasi-absence de culture scientifique—et de connaissance de la langue française, essentielle pour structurer la pensée—dans le personnel politique explique certainement cette malheureuse situation.
pandemic
arrow 16 Mars 2021. Incompétence ? Cynisme ? Peut-être les deux ? ou un problème grave ? De quelle façon nos gouvernements gèrent-ils la vaccination.
Corrélation n'est pas cause. Dès qu'un grand nombre de personnes est confronté à un acte médical - ou assist à un événement quelconque, aller au cinéma, manger au restaurant, assister à un événement sportif - on s'attend à ce que, dans les jours qui suivent, un nombre significatif décède. Si nous prenons 5 millions de personnes, nous nous attendons à ce que 50 000 meurent dans l'année. Comme il y a 365 jours par an, cela signifie que 137 personnes en moyenne mourront le jour suivant. Des millions de personnes ont été vaccinées contre la COVID-19 - et c'est une excellente nouvelle - de sorte que nous nous attendons à ce que, après la vaccination, mais sans qu'il y ait de relation de cause à effet, environ 1 000 personnes meurent dans la semaine qui suit. Nous pouvons même dire quelque chose sur la cause de ces décès : dans un grand nombre de cas, ce sera la conséquence d'un événement cardiovasculaire. Le seul véritable effet secondaire significatif des vaccins auquel nous devons nous attendre - sans savoir à l'avance combien de personnes seront touchées, mais ce nombre sera faible - est une forte réaction allergique, voire un choc anaphylactique. Les campagnes de vaccination ayant été un échec total, le cynisme pourrait l'emporter : créer la panique est un moyen d'avoir moins de candidats à la vaccination. Cependant, nous savons bien que le savoir ne peut pas être le résultat d'un vote, et que les politiciens ont moins de connaissances et une intelligence plus faible que ceux que nous préférerions voir aux commandes. Au vu des chiffres rapportés, il semble peu probable que la vaccination soit la cause des accidents mortels retenus par les réseaux sociaux. Même si c'était le cas, leur nombre doit être relativisé : plusieurs centaines de personnes meurent de la COVID-19 chaque jour en Europe, alors que, avec les données disponibles, la grande majorité ne mourraient pas si elles avaient été vaccinées.

arrow 15 Mars 2021. Oublions les scènes apocalyptiques et regardons le spectacle la vie.
À Hong Kong, la Fondation Croucher a lancé un programme très intéressant d'étude de la biodiversité dans la ville. La plupart d'entre nous sont familiers avec ses gratte-ciel et son énorme densité humaine, mais Hong Kong est un endroit merveilleux pour observer les animaux et les plantes. À la frontière entre les tropiques et la région paléarctique, Hong Kong abrite un grand nombre de formes de vie. Jetez un coup d'œil à un premier catalogue de ce que l'on peut y trouver !
arrow 12 Mars 2021. Un foyer de peste porcine africaine en Malaisie suscite l'inquiétude en Chine.
La peste porcine africaine est une maladie hémorragique virale grave qui tue les porcs en masse (jusqu'à 50 % de la population porcine en Chine a été tuée lors de récentes épidémies). Cette maladie, causée par un virus à ADN double brin, n'infecte pas l'homme. Elle est transmise par les tiques, mais aussi lorsque les animaux mangent de la viande d'animaux contaminés et même, très probablement, d'animal à animal. Aucun vaccin n'est disponible à l'heure actuelle. Le virus a été identifié chez un sanglier en 2020 en Allemagne..
arrow 28 Février 2021. Des virus liés au SRAS-CoV-2 ont également été découverts dans un tuyau d'évacuation thaïlandais.
Cela établit que l'origine du tristement célèbre virus se trouve en Asie du sud-est, à côté de la province du Yunnan en Chine. Des grottes habitées par des chauves-souris sont également explorées au Laos. Cette information n'est pas vraiment nouvelle puisque le RaTG13 provient de la même région. Il reste encore difficile de comprendre comment un site de clivage "sensible à la furine" a été introduit dans le virus qui est devenu le SRAS-CoV-2, le rendant ainsi très contagieux. L'OMS a par ailleurs identifié les études sur le virus Nipah comme sujet de recherche prioritaire, notant qu'il provoque lui aussi une maladie grave chez le porc, animal qui est souvent un relais pour l'adaptation du virus à l'homme.
arrow 21 Février 2021. Deux virus trouvés chez des chauves-souris rhinolophes dans le nord-est du Cambodge sont très voisins du SARS-CoV-2.
La séquence du génome viral, conservée dans un congélateur pendant plus d'une décennie, a une identité de 92,6 % avec le SARS-CoV-2 à l'origine des pandémies de Covid-19. C'est moins que les 96 % d'identité du virus RaTG13 stocké au laboratoire BSL-4 de Wuhan, mais c'est très significatif. Comme on pouvait l'attendre, certains chercheurs interprètent cette découverte comme suggérant que le CoV-2 du SARS ne s'est pas échappé d'un laboratoire, oubliant que certains laboratoires stockent des centaines de virus dans leurs collections après leur découverte dans la nature. En parallèle, une épidémie de COVID-19 a été identifiée chez 32 ressortissants chinois au Cambodge, liée à une boîte de nuit. Une fois de plus, cela souligne le rôle très négatif des environnements surpeuplés dans la propagation de la maladie et met en évidence, une fois de plus, le rôle critique des aérosols.
arrow 20 Février 2021. La pandémie de COVID-19 est à un tournant.
À première vue, c'est une bonne nouvelle : le nombre total de cas et de décès dus à la pandémie est en nette diminution.
pandemic
Pourtant, ce n'est pas le moment de baisser la garde, car il apparaît maintenant que la gestion de l'épidémie a été extrêmement différente dans les différents pays, avec des résultats remarquablement différents (à noter que les échelles verticales indiquant le nombre de cas quotidiens diffèrent selon les pays).
future wave
La stabilisation et parfois l'augmentation du nombre de cas peut provenir des changements dans les souches locales qui infectent les gens. Elle peut aussi, du moins en partie, refléter la manière dont se déroule la campagne de vaccination. Une vaccination trop lente fait que le virus a le temps d'évoluer et d'échapper rapidement au contrôle des vaccins actuels. Cela signifie que nous pouvons nous trouver à un tournant assez dangereux, lié à la fois à la manière dont les gens se comportent (et ont certainement changé leur comportement pour le mieux dans des endroits comme les États-Unis) et à la manière dont les gouvernements mettent en œuvre leurs campagnes de vaccination.
arrow 13 Février 2021. Alors que les envoyés de l'OMS ont analysé la situation à Wuhan, aucune information importante n'a été publiée.
Ce n'est malheureusement pas du tout surprenant. Nous avons déjà discuté le fait que parce que l'Institut de virologie de Wuhan est un laboratoire de classe BLS-4 (le plus haut niveau de biosécurité), il est supervisé par des autorités qui doivent respecter le plus haut niveau de confidentialité, d'information classifiée. Cela est dû aux règles liées à la biosûreté et, naturellement, aux services dits "secrets" qui y sont associés. Le plus souvent, les gens ne prennent pas cette règle au sérieux, et considèrent que les informations circulant entre les personnels concernés seront un jour ou l'autre rendues publiques. Si cela se produit parfois, c'est en fait rarement le cas, sauf des décennies après les faits, voire jamais. Au surplus, la manière dont les contacts sont établis entre personnes impliquées vise à prévenir les fuites, même sous la torture. La conséquence évidente, qui aurait dû être rendue publique - ce ne sont pas des informations confidentielles - est que pas un seul fait intéressant ne pourrait ressortir d'une visite d'un laboratoire de niveau de sécurité biologique 4 ! La seule façon d'obtenir des informations est de reconstituer des scénarios fiables et plausibles. Il est alors curieux que les media de masse n'aient pas vraiment discuté de ces faits, ni du fait que Peter Daszak, qui faisait partie du comité de l'OMS, ait aussi fait partie des personnes qui ont soutenu financièrement et en pratique la recherche dans ce laboratoire. Quelques commentaires sont faits ici et là, mais rien de sérieux. Une autre question évidente est la manière dont les virus sont mis à la disposition des laboratoires de virologie. Comment sont-ils transportés, par exemple ? En fait, il existe des moyens de le faire de manière sûre (à condition qu'il n'y ait pas d'interférence humaine, comme une attaque terroriste par exemple, pour mettre la main sur l'échantillon). Les échantillons biologiques sont suffisamment fragiles, de sorte qu'il est assez facile de mettre en place des conteneurs autodestructeurs. Pourtant, on aurait pu s'attendre à voir des articles explorant cette question. Et aussi d'autres questions ouvertes liées au transport, qui, là encore, ressemblent davantage à ce que l'on peut lire dans des fictions comme Red Sparrow, ou, plus en rapport avec la pandémie actuelle, The End of October. Dans un monde dominé par le déluge d'informations erronées, les questions les plus évidentes ne sont même plus posées.
arrow 2 Février 2021La gestion de la pandémie de COVID-19 diffère considérablement selon les pays.
rank Cependant, il semble que la deuxième vague de la maladie ait été généralement moins bien gérée que la première. L'institut Lowy en Australie explore la manière dont la COVID-19 est gérée, et tente d'identifier les caractéristiques socio-politiques et économiques qui ont un impact sur cette gestion. Si l'Europe dans son ensemble a connu un succès significatif au départ, elle se trouve aujourd'hui à la traîne en termes de taux de réussite. La géographie joue un rôle essentiel, les îles étant généralement beaucoup plus aptes à contrôler la maladie que les pays continentaux. Les caractéristiques climatiques sont aussi importantes. Enfin, les pays ayant une forte cohésion sociale réagissent beaucoup mieux que les pays dont la population est divisée.
arrow 27 Janvier 2021. Parce que l'évolution n'a pas de grand dessein, elle est myope.
Nous devons être prudents lorsque nous prenons la métaphore anthropomorphique du "point de vue d'un virus". Ce que nous disons derrière cette figure doit tenir compte du fait que nous considérons les virus à court terme ou à long terme. Si un virus doit avoir une descendance pendant une longue période, il doit éviter de tuer une grande partie de ses hôtes, ce qui implique une liste de fonctions spécifiques, avec une variété de scénarios, selon que la descendance du virus est importante ou, au contraire, limitée. En revanche, lorsqu'un nouveau virus émerge comme agent pathogène, il ne peut pas "décider" qu'il existera pendant longtemps. À court terme, il se contentera souvent de maximiser sa progéniture. Et cela peut se faire au prix de la mort de ses hôtes. C'est une caractéristique importante qu'il faut garder à l'esprit dans le contexte de l'épidémie actuelle : Pendant un certain temps encore, nous pouvons être confrontés à des variants qui auront une virulence accrue. Les aérosols dans les espaces confinés sont inquiétants, mais la recherche se développe pour créer des systèmes d'aération qui tueront les virus, empêchant ainsi la contamination d'une personne à l'autre. Ce type de système, s'il est efficace, pourrait être utilisé dans les transports, les restaurants et d'autres lieux où la densité humaine est importante.
arrow 24 Janvier 2021. De très nombreuses souches du virus SARS-CoV-2 circulent, et faute de données de séquence correctes, on ne sait pas les associer correctement à leur virulence.
Il n'y a pas d'accès facile aux séquences génomiques du virus et bien des métadonnées (caractéristiques des patients et de la maladie) sont insuffisantes ou fantaisistes. Souvent les producteurs de séquences les gardent pour eux ! Voici quelques questions ouvertes :
1/ Il y a une différence très surprenante entre l'épidémie en Afrique sub-saharienne (et dans les pays au nord de l'Afrique du Sud) et ce qui se passe aux USA pour les Afro-Américains. Cela semble indiquer un effet environnemental, mais c'est plus probablement une combinaison d'un effet génétique protecteur et d'une sensibilisation différente. Toutes sortes de combinaisons sont possibles. Il serait bon de savoir ce que nous pouvons en tirer, en particulier en nous souvenant que le virus est un virus enveloppé, ce donne un rôle inexploré aux lipides par exemple, ce qui implique la génétique bien sûr mais aussi l'alimentation :
a/ Alimentation. Elle diffère énormément suivant les lieux, avec des familles de nourriture extraordinairement distantes.
b/ Autres infections, hygiène: idem.
c/ Climat (température, humidité, UV...)
d/ Densité locale de la population.
e/ Métiers.
Il nous faudrait un point de comparaison. Pouvons-nous identifier aux USA les Africains récemment devenus Américains ? Une situation un peu du même genre existe en France métropolitaine, entre les Antillais et les Africains. Est-il possible d'avoir une idée de la sévérité de la maladie chez ces groupes ?
Pour le caractère génétique un article intéressant à propos des gens d'Extrême Orient suggère que le contact avec les coronavirus est très ancien.
Il faut noter que ce qui peut protéger après une première infection par un virus donné peut évidemment, comme nous l'avons souligné déjà, sensibiliser pour une deuxième infection.
2/ Ce qui est anormal dans l'épidémie est l'apparition brusque de la sévérité à partir de 60-65 ans. C'est en fait très anormal pour les maladies virales. En réalité, dans un très grand nombre de cas, les infections virales sont particulièrement dangereuses pour les enfants y compris très jeunes. Le cas de la grippe est à part : ce n'est pas la maladie proprement dite qui est si dangereuse pour les personnes âgées, mais le fait que le virus inactive les défenses immunitaires, déjà un peu diminuées avec l'âge, et favorise l'apparition d'autres maladies, généralement bactériennes, qui deviennent alors mortelles. Il est alors important de comprendre ce qui s'est passé autour de 1955-1960. Il y a eu là une épidémie qui ne s'est pas reproduite depuis, la grippe H2N2. Pourrait-elle avoir sensibilisé la population infectée à la COVID-19 ? À ce propos, savons nous comment H2N2 s'est répartie dans le monde ? Quid de l'Afrique ? Il serait intéressant de superposer la carte avec celle de la sévérité aujourd'hui. Bien sûr il ne faut pas oublier les maladies digestives. Elles sont souvent relativement inaperçues, mais elles ont beaucoup changé ces dernières années (cf "gastros", à norovirus, etc).
3/ Pour la propagation de l'épidémie, il est plus que probable que les différents mutants se propagent différemment. Le plus important est la qualité des métadonnées. Nous devons de fait attendre l'apparition d'un variant atténué ou qui aura changé de tropisme au moins à moyen terme. À court terme comme nous en avons discuté, il n'est pas impossible que la virulence augmente, avant de baisser sérieusement.
4/ Des modèles du point de vue du virus seraient intéressants. C'est de la théorie des jeux, avec comme objectif pour le virus l'aptitude à se reproduire de manière à continuer à exister à long terme... Il faut donc commencer par faire une liste des fonctions nécessaires pour assurer cette contrainte et voir ce que cela donne.
5/ Enfin, il faut tenir compte des sociétés humaines : c'est là qu'apparaissent les événements super-propagateurs.
arrow 19 Janvier 2021. Maintenant que la campagne de vaccination est en cours, nous devons évaluer correctement le taux de réussite des vaccins.
Les différentes études qui ont servi à autoriser les vaccins sont loin de reposer sur des protocoles cliniques corrects. Il semble peu probable qu'ils aient autant de succès que le prétendent leurs producteurs. Cependant, comme un grand nombre de personnes ont maintenant été vaccinées, nous devrions pouvoir connaître le taux de réussite réel des premiers vaccins, et des protocoles corrects devraient être utilisés à l'avenir. En outre, si la vaccination est évidemment la meilleure solution pour l'instant, il semble très important d'identifier correctement les effets secondaires négatifs. En particulier, les autorités sanitaires norvégiennes disposent d'indications que les personnes très fragiles pourraient être affectées négativement par la vaccination, y compris en termes de mortalité accrue, mais cela demande à être confirmé.
arrow 16 Janvier 2021. Le potentiel pandémique d'un virus est étroitement lié à sa capacité à produire des cas asymptomatiques.
Très tôt, au cours de la présente pandémie, nous avons constaté que si un nombre important de personnes étaient infectées sans symptômes, l'épidémie deviendrait rapidement incontrôlable. Bien que cela soit simple à comprendre, cela n'a pas encore été pris en compte dans le cas de futures pandémies. Par exemple, le virus de la grippe H5N1 est extrêmement virulent, mais comme il ne semble pas donner de cas asymptomatiques (ou très légers), le virus ne s'est pas propagé dans la population humaine, malgré la façon dont il a été présenté initialement. C'est pourquoi nous ne devrions probablement pas nous préoccuper des autres virus de la grippe (qui doivent cependant être surveillés de près), mais nous devrions envisager le fait que les variants H1, H2 et H3 sont les sources les plus probables de futures pandémies graves de grippe. Le virus H3N8, qui infecte les chiens, les chevaux et les phoques, est malheureusement un candidat pour de futures épidémies, et le virus H2N2, qui avait créé une grave pandémie en 1957-1958, pourrait revenir en force, car l'immunité correspondante a probablement pratiquement disparu dans la majeure partie de la population humaine.
En termes de médicaments, nous devrions rechercher des produits chimiques qui pourraient atténuer les symptômes les plus graves, tout en laissant au virus suffisamment de place pour générer une réponse immunitaire chez ses hôtes.
arrow 13 Janvier 2021. Le SRAS-CoV-2 évolue très rapidement pour échapper au système immunitaire adaptatif.
Une étude (non encore revue par des pairs) réalisée par le laboratoire de Rino Rappuoli a montré in vitro que le virus pouvait échapper à la neutralisation par les anticorps des patients après quelques mutations apparues lors d'une croissance par dilution successive sur un milieu contenant des anticorps. Les changements observés sont similaires à ceux observés récemment au Royaume-Uni et en Afrique du Sud, ce qui jette un doute sur l'efficacité future du vaccin actuel. Outre cette mise en garde, il convient de noter que cette expérience est typiquement de la catégorie "gain de fonction", et qu'elle aurait dû être développée dans des environnements extrêmement sécurisés (au moins niveau BSL-3 +). Une description adéquate des installations concernées est absente de cet article, ce qui constitue une sérieuse violation des mesures de sûreté/sécurité, d'autant plus que les auteurs de l'étude appartiennent à des laboratoires situés en Italie (Sienne et Trieste), aux États-Unis (La Jolla et Austin) et à Londres (Royaume-Uni), ce qui suggère que le virus pourrait avoir été transporté d'un endroit à l'autre.
arrow 11 Janvier 2021. L'origine du SARS-CoV-2 restera probablement inconnue.
L'OMS a mis en place une équipe qui va maintenant enquêter sur l'origine de l'épidémie de COVID-19. Bien que cela semble être souhaitable, il est probable que cela ne permettra pas de connaître vraiment l'origine du virus. En particulier, le laboratoire BSL-4 de Wuhan sera au centre de l'enquête, mais, chose assez surprenante, un membre de l'équipe de l'OMS, bien qu'il soit manifestement un expert, appartient à une institution qui a financé ce laboratoire particulier ! Il est aussi essentiel de comprendre que tous les BLS-4 sont strictement soumis à des règles de confidentialité extrêmes, dans le monde entier. En effet, ils traitent d'informations classifiées, pour des raisons évidentes : les connaissances techniques associées à des agents pathogènes dangereux pourraient être utilisées par des personnes malveillantes ou même par des États voyous. Il s'ensuit que les informations non seulement sur des pratiques spécifiques, mais aussi sur le type d'expériences et les espèces concernées ne seront jamais librement accessibles. Cela implique que les personnes qui prétendront être au courant de ce qui se passe dans ces laboratoires ne disposeront d'aucune information fiable. En outre, la mise en œuvre d'informations classifiées dans ce domaine implique que la vie-même de ceux qui voudraient communiquer ce qu'ils savent est certainement menacée. La seule réflexion rationnelle que nous pourrions avoir est d'essayer d'interdire à tout laboratoire, où que ce soit, de stocker des agents pathogènes dangereux au même endroit. Et encore, s'il est techniquement possible de transporter des agents pathogènes de manière totalement sûre, le fait de les placer dans des dispositifs de transport et de les en retirer est susceptible de créer des accidents. Comme d'habitude avec les technologies très évoluées, les accidents sont une certitude, pas l'exception. C'est pourquoi il n'est pas juste de prétendre que quoi que ce soit est exempt d'accident. La seule façon rationnelle de procéder est de savoir comment se comporter après qu'un accident
est arrivé.
arrow 9 Janvier 2021. Le SRAS-CoV-2 évolue rapidement. Il devient important de prendre le point de vue du virus et d'anticiper la façon dont il va affecter la population.
L'analyse fonctionnelle est la clé pour comprendre la vie. Cette approche fait l'inventaire des fonctions attendues pour tous les agents impliqués dans les processus vitaux et explore leurs relations. En bref, un agent particulier a une fonction principale qui est développée en un réseau de fonctions auxiliaires, suivant deux grands types de hiérarchies : les hiérarchies dendritiques (arborescentes) et les hiérarchies segmentées (fondées sur des "organes" hiérarchiques organisés individuellement. C'est illustré par exemple par les fonctions d'une imprimante (fonction maîtresse : imprimer), qui nécessite des fonctions d'aide comme l'alimentation électrique, l'alimentation en encre, l'alimentation en papier, etc.
functional analysis
Dans cette optique, nous pouvons explorer les fonctions auxiliaires d'un virus, en supposant que sa fonction principale est de continuer à produire une descendance à long terme. Il existe de nombreuses stratégies pour atteindre cet objectif, avec deux extrêmes : une importante descendance avec des pertes considérables, ou une petite progéniture peu nombreuse, mais composée d'individus très résilients. Quel que soit le cas, la première fonction auxiliaire est celle qui consiste à trouver un hôte. Cette fonction est limitée par la stabilité du virus dans l'environnement et par la densité des hôtes. Deux caractéristiques majeures sont ici mises en évidence, celle des sociétés humaines et celle de la génétique de la surface des tissus humains, en plus du rôle de l'immunité de surface puis de l'immunité innée. La densité de l'espace urbain favorisera évidemment la propagation du virus. Le manque d'aération dans les environnements fermés favorisera aussi le virus. La façon dont les gens se dispersent après s'être assemblés dans un environnement bondé jouera aussi un rôle important en faveur du virus. Il est important de considérer un aspect dérivé, celui de la stratification de la population par âge, en particulier en fonction de la façon dont les gens se rassemblent et se déplacent en fonction de leur âge. Il y a là un rôle évident des écoles, des universités, des restaurants et des bars, etc. Une caractéristique notable de ces environnements est qu'ils varient considérablement avec l'âge. Un deuxième point lié à l'âge est la gravité de la maladie, car une maladie grave restreint considérablement les mouvements des personnes concernées. Ainsi, du point de vue de l'avenir du virus, il semble probable qu'il évoluera vers des formes qui auront progressivement tendance à infecter plus efficacement la population jeune. Cela devrait être pris en compte pour anticiper le profil de l'épidémie. Même si le virus s'atténue progressivement, le fait d'infecter un grand nombre de jeunes gens conduira inévitablement à déplacer l'âge moyen de la létalité vers un âge plus jeune.
arrow 4 Janvier 2021. Le nombre d'articles rétractés sur COVID-19 continue d'augmenter à un rythme rapide.
Le site Retraction Watch continue de rassembler les articles traitant de l'épidémie de COVID-19 qui ont été rétractés. Malheureusement, ce n'est que la partie émergée de l'iceberg à un moment où près de 150 000 articles ont été publiés ou mis en ligne sur ce sujet important. Parmi les nombreux articles traitant du "travail" provenant de sites de "conspirationnistes" (par exemple le rôle de la 5G ou de toutes sortes d'"ondes" sur l'épidémie), il y a beaucoup d'articles qui ont malheureusement considérablement influencé la façon dont les autorités ont traité l'épidémie, ralentissant ainsi d'importantes découvertes qui nous aideraient à lutter contre la maladie. L'utilisation catastrophique de l'hydroxychloroquine (malheureusement, seul un nombre limité d'articles a été rétracté jusqu'à présent) y joue un rôle important, alors que son mauvais usage a non seulement compromis d'importants essais cliniques, mais a probablement aussi augmenté la mortalité de la maladie (notez toutefois que l'article n'est pas encore officiellement publié)
.
arrow 1 Janvier 2021. Une modification remarquable de l'ARN utilisé pour le vaccin BioNTech/Pfizer contre le SARS-CoV-2 devrait empêcher les virus d'utiliser la construction humaine pour accroître ses possibilités d'évolution.
Les ingénieurs qui ont conçu le vaccin ARN anti-SARS-CoV-2 de BioNTech/Pfizer ont eu l'idée de stabiliser
, en modifiant sa structure chimique, l'ARN leurre encapsulé codant un antigène majeur de la surface du virus, parce qu'on sait que l'ARN est une molécule très instable. Par chance, cette modification a une deuxième propriété bénéfique. Comme elle est artificielle cette modification ne peut avoir été prise en compte au cours de l'évolution par aucun processus de recombinaison, de sorte que la probabilité qu'une partie de la construction artificielle se retrouve dans d'autres virus, leur permettant de découvrir de nouvelles façons d'évoluer, sera extrêmement réduite. De la même manière, la polymérisation (dépendante de l'ARN injecté) en un ARN complémentaire sera probablement bien plus difficile. Voici l'astuce (résumée dans une étude très intéressante). Un ARN est constitué de quatre éléments constitutifs, A, U, G et C, qui ont la capacité de s'apparier : A avec U et G, avec C. Maintenant, la partie hétérocyclique du bloc U peut être transformée en une molécule différente appelée pseudouridine, ψ, qui peut toujours jouer le rôle que joue le U dans l'ARN utilisé pour fabriquer des protéines, mais qui modifie de manière subtile la machinerie générale de transcription/réplication.

U-PseudoU
L'ARN modifié est donc beaucoup plus stable et sera utilisé dans les cellules cibles de l'hôte pour fabriquer une bonne quantité de protéines qui seront reconnues par le système immunitaire de l'hôte, le protégeant ainsi contre une attaque du véritable virus du SRAS-CoV-2. Généralement, au lieu d'avoir :
GAAUAAACUAGUAUUCUUCUGGUCCACAGACUCAGAGAGAACCCGCCACC
nous avons dans la construction artificielle du vaccin : GAAΨAAACΨAGΨAΨΨCΨΨCΨGGΨCCCCACAGACΨCAGAGAGAACCCGCCACC
Cette dernière séquence est toujours reconnue par la machinerie qui traduira le "message" de la construction en protéine jouant le rôle de l'antigène, et déclenchera ensuite la réponse immunitaire. Non seulement cela produit le bon antigène mais cela augmente aussi considérablement la sécurité de la construction.