beida
'Αρχαἱ οὖν ἰατρικῆς τρεῖς: ἡ μὲν εὑρσεως, ἡ δὲ εκ τοῦ συστησασθαι τὴν τεχνην, ἡ δὲ ὑφηγησεως.

ΓΑΛΗΝΟΥ ΙΑΤΡΟΣ
ΕΙΣΑΓΩΓΗ

Les principes de la médecine sont donc au nombre de trois : celui de la découverte, celui de la formation de la technique et celui de l'explication.

Introduction au Médecin de GALIEN


Si votre fournisseur le permet
Traduction automatique :
langues autres que l'anglais

Années précédentes

First conjectures on SARS

Nouvelles sur Twitter twitter

Cette page informe sur des questions d'actualité, certaines originales (ce site et cette page, bien qu'en libre accès, sont protégés par Copyleft, la seule contrainte requise étant l'indication de ce site comme source, précisément pour garantir cette liberté). Elle donne aussi des liens destinés à vous aider à retrouver d'autres informations pertinentes, ainsi que des vues plus approfondies sur les sujets qui vous intéressent. Les informations importantes ne sont pas toutes en Anglais ! Le chinois, principalement le Mandarin (Putonghua 普通话), est peut-être la langue parlée par le plus grand nombre dans le monde, suivie par les langues latines (Français, Italien, Portugais, Roumain, Espagnol...), et enfin par l'Anglais (ou peut-être certaine langues indiennes). De même, le Grec fournit la plupart des mots et concepts utilisés en science. Il faut donc aussi chercher l'information dans d'autres langues. La plupart de la littérature chinoise n'a été traduite dans aucune langue occidentale. Le Français n'est pas la seule langue utilisée sur ce site (pour des raisons de commodité de communication, la lingua franca de la science est l'Anglais, et la majeure partie de ce qui se trouve ici est d'abord publié dans cette langue). L'enseignement généralisé du Latin dans les pays de langue latine permettrait facilement, comme au cours des siècles passés, de rétablir une communication ubiquiste de bien meilleure qualé que celle imposée par un Anglais mal parlé et appauvrissant la pensée.

Pour comprendre la biologie, être capable d'écrire à son propos ou d'en parler (et de comprendre ce qu'on écrit et ce qu'on dit...) quelques lectures peuvent être utiles. Nous donnons souvent l'adresse de liens utiles dans la Toile pour retrouver des informations importantes. Nous nous référons à nos propres publications lorsqu'elles sont destinées à un public éclairé non spécialisé. Une page est consacrée à la génomique (pour l'instant en Anglais), mais une information plus étoffée peut être trouvée dans La Barque de Delphes publié aux Editions Odile Jacob en mai 1998, (la version en anglais du texte français a été mise à jour en 2003 et réorganisée, The Delphic Boat (Harvard University Press, Cambridge, USA), et donne une vue plus anglo-américaine de la même connaissance).

Questions sur les gènes, la génétique et le génomes

Dernière mise à jour : 7 juillet 2012

Cette page est régulièrement mise à jour. Vous pouvez trouver des éléments des changements à ce lien.

Publications à usage du public général

Toutes les réponses | Questions seules

Cliquer sur l'épingle pour voir la réponse. Pour les liens internes aux réponses, ouvrir toutes les réponses

blue Qu'est-ce qu'un gène ?
Il existe bien des définitions de ce qu'est un gène. Initialement il s'agissait d'un objet abstrait uniquement repéré au cours des générations par la façon dont certains caractères comme la couleur des yeux ou des cheveux se transmettaient des parents aux enfants. Aujourd'hui, au moins pour un ordinateur (qui ne peut se contenter de définitions floues), il est possible de donner une définition du gène. Il s'agit alors de la représentation formelle d'un fragment d'une longue molécule, l'ADN (pour "Acide DésoxyriboNucléique"), constitué de l'enchaînement de quatre motifs chimiques appelés nucléotides (qu'on nomme souvent d'une expression un peu ambiguë "bases"). Comme cet enchaînement est séquentiel, on le représente comme un texte écrit avec un alphabet de quatre lettres.
Quatre types de nucléotides, notés A, T, G et C forment la molécule d'ADN. Cette molécule est faite de deux brins enroulés l'un autour de l'autre comme un escalier en colimaçon à double révolution:

dna

La chaîne forme un long filament, qu'on peut décrire comme un texte, par exemple: TAATTGCCGCTTAAAACTTCTTGACGGCAA etc. C'est parce que les constituants de base (qu'on peut dire des "lettres") sont de quatre, et seulement quatre, types.
Avec cette description de l'ADN, on peut proposer une définition abstraite (formelle) du gène.
Un gène est un fragment d'ADN, dont les limites sont bien définies, qui, lorsqu'il est modifié par rapport à un ADN de référence (c'est-à-dire, quand le texte correspondant est changé, par transposition, inversion, substitution, insertion ou délétion d'une ou plusieurs lettres) va changer les propriétés générales de la cellule dont il constitue une partie du programme génétique.
L'organisme qui possède le nouveau gène est dit "mutant". Par exemple de multiples gènes definissent la couleur des yeux, de la peau, des cheveux etc. C'est parce que l'ADN correspondant (ou le texte correspondant, si l'on ne considère que la suite des bases écrites sur le papier) n'est pas identique chez les différents individus, qu'on a diverses variation de cette couleur.
Comme on le voit, cette définition est un peu tautologique (comme les définitions du dictionnaire) puisqu'elle fait appel à divers concepts comme celui de programme génétique, dont le cœur est précisément le gène. On trouve là la base d'une propriété remarquable du vivant, la récursivité, c'est à dire l'appel, au sein même d'une définition (ou d'un programme) d'un de ses caractères constituants. Quand on parle de gène, on fait donc l'hypothèse qu'il existe, au travers des générations, quelque chose qui se transmet, le programme génétique, dont le support matériel (effectivement transmis sous la forme de copies identiques de génération en génération) est la molécule d'ADN, possédant un enchaînement particulier des nucléotides qui la composent.
Cette définition est proche de celle qu'on utilise en génétique formelle. En pratique cependant, les chercheurs tendent à restreindre l'usage du terme "gène" à une fraction particulière du texte de l'ADN, pour les raisons suivantes. Des changement dans la séquence de l'ADN ne donnent pas toujours lieu à des modifications visibles de l'organisme par rapport au type "normal". En fait, il existe un polymorphisme important dans la séquence de l'ADN formant le programme génétique de deux individus de la même espèce (c'est-à-dire de petites variations — en moyenne une lettre sur mille dans les gènes humains). Ce polymorphisme n'est pas cependant sans conséquences, mais ces conséquences ne sont souvent visibles qu'après de nombreuses générations, manifestées au cours de l'évolution de l'espèce. Un gène est pour cette raison habituellement considéré comme une collection de séquences voisines d'ADN, appelées allèles, qui ont à peu près la même action au sein des organismes d'une même espèce. On peut trouver à cela une analogie typographique: un même texte de recette peut être écrit avec des typographies différentes, ce qui n'en altère pas, au moins en première approximation, le sens. Le gène devient ainsi une notion quelque peu abstraite, qui comprend non seulement la population des gènes existants, mais aussi tous ceux qui contrôleraient de la même façon un caractère particulier de l'organisme.
Au surplus, l'ADN n'a pas partout le même rôle dans la cellule. Une partie de la séquence spécifie en fait des agents, nommés ARN (un autre type de polymère de nucléotides, un Acide RiboNucléique, semblable, mais non identique à l'ADN) ou protéines, qui ont une fonction particulière pour le développement de la machine cellulaire. Les protéines sont là encore des enchaînements de modules de base, mais cette fois de 20 types différents, appelés acides aminés. Ces protéines effectuent presque toutes les tâches que la cellule a à effectuer (construire son architecture, gérer ses aliments, contrôler son comportement...). On a généralement tendance à considérer seulement ces séquences comme des gènes. Ce sont là les objets qu'implicitement les journalistes appellent "gènes" (bien peu, cependant, cherchent à savoir ce dont il s'agit en réalité). Pourtant, le texte de l'ADN remplit beaucoup de rôles qui s'écartent de cette définition restrictive. En particulier, certaines régions ont un rôle dans le contrôle de la production de tel ou tel agent (ARN ou protéine), tandis que d'autres régions jouent plutôt le rôle d'"espaceurs" (pour le repliement de l'ADN au sein du noyau de la cellule) ou de "minuteurs" (pour assurer le timing approprié des différentes opérations auxquelles la cellule a à faire face). Pour ces raisons, il est plus approprié de parler de Séquences Codantes de l'ADN (on utilise l'abréviation de l'expression anglaise "Coding DNA Sequences", CDS) pour les régions de l'ADN qui codent les protéines. Ce sont ces régions qui sont considérées quand on parle (bien à tort) du nombre des gènes d'un organisme. Il est certainement erroné de limiter la définition des gènes aux CDS, et cela explique le nombre des querelles où s'embourbent bien des historiens ou des philosophes intéressés par la biologie.
Après avoir rappelé cinq fonction principales des gènes nous aurons par la suite recours à cette simplification, qui a le mérite de donner une définition relativement limitée de ce qu'est un gène. La métaphore pratique qui semble la plus appropriée consiste à voir l'ADN comme le texte d'un programme d'ordinateur, où les CDS se comportent comme des routines. Bien sûr, il est bien connu qu'un programme est fait de beaucoup d'éléments: zones de contrôle, commentaires, etc... Omettre une région de contrôle, par exemple, peut empêcher l'action d'une routine et le comportement du programme devient alors identique à celui d'un programme où manque la routine.

On a ainsi des gènes codant:

1. des agents (ARN ou protéines: une même séquence d'ADN peut parfois coder plusieurs agents; formellement à chaque type de codage devrait correspondre un gène formel, et ainsi une même région de l'ADN pourrait spécifier plusieurs gènes)
2. des régions de contrôle du niveau d'expression des agents (régions régulatrices, "promoteurs")
3. des espaceurs (régions d'organisation de l'architecture de l'ADN dans la cellule)
4. des minuteurs (régions utilisées pour espacer dans le temps la synthèse d'agents ou la disponibilité de telle ou telle région de l'ADN envers des éléments de contrôle
5. des réserves génétiques (régions généralement non fonctionnelles au cours de la vie de l'individu, mais qui peuvent le devenir au cours des générations, régulièrement ou non)

Le nombre typique des gènes (au sens restreint de CDS, qui est le sens employé dans les bases de données où sont annotées les séquences) des microbes habituels de notre environnement (bactéries) se situe entre 1 500 et 5 000. Le nombre des gènes humains n'est pas connu, et une controverse continue en ce moment à propos de ce nombre. La majorité des chercheurs préfère proposer le nombre de 30 000 environ, auquel il faut ajouter au moins 20 000 gènes codant des ARN (dont la fonction est presque systématiquement totalement inconnue aujourd'hui). Pourtant, une fois écartées les redondances, le dénombrement des gènes à partir des séquence d'ARN isolées d'un petit nombre de cellules a plutôt conduit à une valeur sensiblement inférieure: en 2004 le consortium Ensembl identifie moins de 30 000 gènes. Au contraire, si l'on suppose que les gènes qui ont plus ou moins la même fonction diffèrent les uns des autres dans chaque type cellulaire (il y un plus de 200 types de cellules dans le corps humain), le nombre réel pourrait être plus élevé. Il faudra encore quelque temps pour être fixés sur ce nombre. De toutes façons, bien sûr, ce n'est aucunement le nombre de gènes qui fait la complexité d'un organisme, mais les relations qu'ils entretiennent: on peut faire des objets très différents, parfois très compliqués à partir d'un petit nombre de composants de base.

blue Qu'est-ce qu'un génome ?
La définition habituelle du génome est qu'il représente la collection de tous les gènes d'un organisme. Pourtant, un génome est beaucoup plus que cela. Ce n'est pas seulement l'ensemble de tous les gènes présents dans le noyau des cellules de l'organisme, mais aussi la façon dont ces gènes sont organisés au voisinage les uns des autres. Si vous considérez par exemple la recette de votre plat favori, vous comprenez facilement que connaître simplement la liste de ses ingrédients ne vous permettrait pas de préparer le plat! Le génome est le texte complet de l'ADN présent dans chaque cellule de l'organisme. Il comprend par conséquent les régions correspondant aux CDS, aussi bien que les régions qui se trouvent entre elles ("régions intergéniques").
L'organisation du génome est si importante qu'en fait on peut souvent apprendre quelque chose des gènes d'un génome en en étudiant le voisinage, les gènes ayant des fonctions reliées se trouvent souvent dans une certaine proximité les uns des autres.

blue Quand peut-on dire qu'un génome a été complètement séquencé ?
Lorsque, le 26 juin 2000, les représentants du Projet Génome Humain (HGP), de concert avec les dirigeants de la compagnie Celera annoncèrent que le projet était terminé, ils affirmaient qu'ils avaient réussi à produire un brouillon de la séquence du génome humain. Qu'est-ce à dire ? Le génome a-t-il été complètement séquencé ? Sera-t-il jamais complètement séquencé ? En fait, pas du tout. Et cela explique bien des questions que beaucoup se posent à propos des raisons réelles qui sous-tendaient cette annonce. Un brouillon n'est qu'une couverture plus ou moins ordonnée de la séquence du génome, déterminant la séquence locale de fragments du génome, à partir d'une redondance de lecture de 4- à 5-fois (en moyenne la même base aura été séquencée en 4 à 5 fragments différents, se recouvrant plus ou moins). Cette déclaration faisait référence à des données de séquence obtenue principalement sous la forme de fragments longs de 10 000 paires de bases environ, qui avaient été approximativement placés dans chaque chromosome du génome humain. C'est évidemment très loin de l'obtention de la séquence complète du génome humain. Il a fallu encore plus de cinq ans pour approcher d'une séquence proche de la complétion.
On dit bien souvent qu'un génome est séquencé en entier quand une série de séquences, recouvrant la plupart du génome, est obtenue. C'est là qu'il est très important de faire la différence entre les programmes de séquençage de génomes bactériens, où l'annonce de la complétion du programme est le plus souvent annoncée quand la séquence est effectivement connue en entier, et tous les autres programmes, où les chercheurs annoncent la fin du programme bien avant que la séquence complète soit connue ! De fait, quand en décembre 1999 la séquence des 56 millions de bases (Mb) du chromosome 22 de l'Homme a été annoncée comme complète, seules 33,5 Mb avaient été réellement séquencées, en plusieurs morceaux, séparés par des interruptions de longueur plus ou moins bien connue. De la même manière, quand en avril 2000, il a été dit que la séquence complète du génome de la mouche Drosophila melanogaster était connue, seules 120 Mb avaient été séquencées, en fragments discontinus, alors que la longueur totale du génome est de 160 Mb environ. La même chose s'applique au génome du nématode Caenorhabditis elegans, et même à la séquence du génome de la levure Saccharomyces cerevisiae, qui ne comprend pas les régions comprenant environ 150 à 200 gènes codant l'ARN des ribosomes, petits organites essentiels pour la synthèse des protéines. Ces régions hautement répétées sont en effet, en pratique, impossible à déterminer avec les moyens dont nous disposons actuellement.

2022 Le séquençage complet du génome humain est désormais pratiquement terminé, vingt ans après l'annonce correspondante.

Afin d'obtenir la séquence "complète" d'un génome, il faut partir du "brouillon", combler les interruptions, réduire les ambiguïtés et ordonner soigneusement les séquences les unes par rapport aux autres. On admet généralement aujourd'hui que la séquence d'un génome est terminée lorsqu'elle ne comporte pas plus d'une erreur tous les 10 000 bases. Pour atteindre ce niveau il faut habituellement, avec les approches courantes (qui utilisent la fragmentation aléatoire du génomes suivie du séquençage des différents fragments, ce qu'on appelle de l'américanisme approche "shotgun"), une couverture qui se situe entre 10 et 15 par base (en gros on séquence environ dix fois le génome pour être certain de trouver au moins une fois chaque base dans au moins un fragment). Mais les séquences obtenues omettent beaucoup de régions où l'ADN ou bien ne peut pas être cloné, ou bien est si répétitif qu'il est impossible d'assembler les fragments séquencés les uns avec les autres. Dans les génomes des animaux ces régions comprennent la région généralement centrale des chromosomes (les centromères) et leurs extrémités (les télomères). Il y a aussi, réparties tout au long des chromosomes, d'autres régions hautement répétitives, habituellement visibles en microscopie optique comme apparaissant d'une couleur différente (hétérochromatique) quand on les compare avec les régions comportant la plupart des gènes. On ne peut pas, pourtant, exclure la présence de quelques gènes (CDS) dans ces régions. Il est donc bien clair qu'il y aura bien des discussions pour fixer le moment où la séquence du Génome Humain sera réellement terminée ! En août 2004, outre les régions hétérochromatiques et les centromères, il restait plus de 150 interruptions non encore séquencées. De fait, si nous n'avons pas de nouveaux progrès révolutionnaires dans l'obtention de la séquence de l'ADN, il est peu probable que nous puissions déterminer la séquence complète de ce génome avant quelque temps, au moment où les extraordinaires progrès des méthodes de séquençage permettront de séquencer de très longs fragments d'ADN en une seule fois.

Pour une réflexion sur la complétion de la séquence des génomes, voir ici .

blue Qu'est-ce qu'une maladie génétique ?
Les maladies, au sens habituel, sont causées par des agents étrangers à l'organisme: produits chimiques (poisons), microbes ou virus. Certaines maladies, pourtant, apparaissent spontanément, sans agent causal extérieur apparent. En un sens, le simple fait de vieillir est une maladie de ce type (bien que vieillir soit perçu comme un processus normal). Des individus autrement normaux découvrent parfois que leur santé se détériore soudainement, par exemple parce que leurs muscles disparaissent peu à peu, jusqu'au terrible moment où ils ne peuvent plus marcher ou respirer. D'autres deviennent burtalement sourds ou aveugles (ou peuvent naître sourds ou aveugles). Cela peut apparaître spontanément, de façon plus ou moins sporadique, mais on observe souvent que plusieurs personnes d'une même famille sont affectées de la même maladie au cours de leur vie. C'est l'indication (mais non la preuve !) que la maladie est transmise de façon héréditaire.
Parce que nous recevons nos gènes de chacun de nos parents nous avons normalement deux copies de chaque gène (sauf pour les gènes qui sont présent dans les chromosomes sexuels, X et Y). La plupart du temps (pas toujours) une copie fonctionnelle est suffisante pour que notre corps fonctionne normalement. Pourtant, il peut arriver que les deux copies aient été affectées par quelque mutation, faisant que la fonction du gène ne peut plus opérer normalement. Dans d'autres cas (heureusement plus rares) une copie mutée d'un gène peut même affecter l'action de la copie normale. Dans ces situations, nous avons affaire à une maladie génétique. Parce que la maladie peut être cachée par la copie normale au travers de nombreuses générations, une maladie génétique peut sauter des générations et apparaître longtemps après qu'on l'avait pensé disparue. En fait, la réalité est encore plus surprenante: parce que nous avons tellement de gènes (et on sait déjà que plus de 5 000 gènes peuvent conduire à des maladies génétiques chez l'Homme), chacun d'entre nous est porteur de plusieurs maladies génétiques ! Mais notre descendance n'en est généralement pas affectée, parce que la probabilité de trouver le même gène muté chez les deux parents reste très faible.
Ce n'est plus vrai pourtant (statistiquement, bien sûr) si nous épousons de proches parents (cousins germains par exemple). Ce n'est plus vrai non plus dans les petites communautés (dans les îles par exemple) où le choix des partenaires est forcément limité. C'est pourquoi l'on y trouve une fréquence importante de maladies génétiques. C'est aussi ce qui explique l'observation que certaines maladies génétiques sont plus fréquentes chez les Asiatiques ou les Caucasiens par exemple (ainsi la mucoviscidose, fréquente en Europe, est très rare en Asie). Une conséquence intéressante est que les mariages interethniques sont habituellement beaucoup moins susceptibles de produire des maladies génétiques que les mariages plus consanguins... Cette observation pourrait expliquer la règle, dans de nombreuses sociétés humaines, qui interdit l'inceste, alors que de nombreuses règles tendent à limiter l'endogamie (mariage à l'intérieur de la communauté) et à encourager l'exogamie (mariage à l'extérieur de la communauté). Pourtant, les structures sociales les plus invraisemblables ayant été plus ou moins explorées par nos sociétés (l'arbitraire est l'apanage de l'Homme), il existe parfois des règles d'endogamie, fixées par la religion, qui ont évidemment pour conséquence une augmentation considérable des maladies génétiques dans les communautés concernées.

blue Qu'est-ce que la pharmacogénomique ?
La définition de ce qu'est un gène nous a appris qu'il s'agit d'un concept abstrait qui recouvre toute une collection de séquences très voisines, appelées allèles. Cela signifie qu'il y a variation d'un individu à l'autre au sein de la même espèce, en fonction du polymorphisme de la séquence du gène. Le plus souvent, ce polymorphisme n'a pas d'effet connu ou visible. Pourtant, il peut correspondre à une différence subtile dans le comportement du produit du gène dans son environnement. Cela peut conduire par exemple à ce que différentes personnes aient des comportements alimentaires différents. En général ce n'est pas un problème, parce que chacun tend à adapter son propre environnement (sa nourriture en particulier) à ses besoins. Il y un a cas pourtant où cela ne peut pas être aisément contrôlé. C'est le cas de la prise de médicaments. De fait, le sort des médicaments diffère significativement de personne à personne (c'est pourquoi, sur l'étiquette des médicaments, on trouve des instructions pour leur usage, et des avertissements indiquant les contre-indications). Parfois cela peut conduire à des situations très dangereuses: le médicament peut être très toxique pour certains, alors qu'il est tout à fait inoffensif pour les autres (c'est la situation qui se produit lorsqu'on est allergique à un médicament, par exemple). Comme cela est dû à la présence d'un allèle d'un gène, il serait très utile d'être capable de savoir d'avance comment chacun réagira à tel ou tel médicament. L'objectif principal de la pharmacogénomique est précisément de relier le polymorphisme génétique avec l'usage des médicaments, de façon à ce que chacun puisse savoir comment il réagira, afin de minimiser les effets adverses possibles. Il s'agit là d'un côté bénéfique de l'établissement de la carte génétique de chacun d'entre nous. Comme d'habitude avec les progrès technologiques, ils sont à double face et peuvent être utilisés pour le bien, ou au détriment des personnes (on peut évidemment aisément penser que l'établissement d'une carte génétique pourrait donner des éléments statistiques concernant la durée de vie probable de chacun...). Nous devons donc veiller à en contrôler l'usage.

blue Qu'est-ce que la biotechnologie ?
La biotechnologie est un concept hybride créé pour résumer les progrès faits dans les technologies qui utilisent les organismes vivants ou d'autres systèmes biologiques à la base de procédés industriels (habituellement dans l'industrie agro-alimentaire ou la médecine, mais aussi dans d'autres types de technologies). L'Homme a utilisé la biotechnologie depuis la découverte du feu, mais l'usage raisonné de cette technologie n'a probablement commencé qu'avec le Néolithique, il y a quelque dix mille ans. A cette époque l'Homme a commencé la domestication du bétail, planifié la croissance de plantes herbacées et d'arbres et a commencé à produire sciemment des produits fermentés (produits laitiers, bière et vin), aussi bien que des textiles dérivés de plantes, du papier et des charpentes ou des outils produits à partir d'arbres domestiqués.
Nos aliments les plus familiers sont dérivés de procédés biotechnologiques: c'est le cas du fromage et du yaourt, du saucisson, du choux fermenté (choucroute, et choux fermenté qu'on trouve en Chine du Nord), du pain, de sauces comme le natto Japonais, du vinaigre, et de beaucoup de types de boissons, bière et vin en particulier. Tous ces produits sont obtenus avec l'aide de microorganismes cultivés: bactéries et champignons (levures pour la bière et le vin, et moisissures pour le fromage). Pourtant, le terme biotechnologie a été pris par beaucoup, journalistes en particulier, comme se référant seulement aux procédés restreints au génie génétique et aux techniques associées, en une variété d'applications de la médecine jusqu'à l'agriculture. En raison de cette connotation, parfois prise très négativement, beaucoup oublient habituellement que la biotechnologie est l'une des plus anciennes technologies utilisées par l'Homme. A cet égard il est important de remarquer que les fameux Organismes Génétiquement Modifiés, ne sont rien d'autre qu'une forme moderne de la domestication.
Dans le procédé de fermentation, des organismes unicellulaires, comme des levures, des moisissures ou des bactéries, se multiplient dans des milieux enrichis avec des sucres, de l'amidon ou des déchets de plantes (comme le résidu de rafles de maïs). Au cours de ces procédés ils produisent de l'alcool, de l'acide lactique, de l'acide acétique, du gaz carbonique ainsi que toutes sortes d'autres produits spécifiques de l'espèce cultivée et des milieux de croissance utilisés. La mousse et l'alcool de la bière sont le résultat de ces procédés, comme le sont les trous du pain et de certains fromages ou l'acidité du yaourt. Certains procédés de fermentation permettent d'obtenir des produits particuliers comme des antibiotiques, ou même des produits normalement synthétisés par le corps humain.

blue Qu'est-ce que le génie génétique ?
Le génie génétique (aussi appelé parfois manipulation génétique) est le procédé par lequel le génome normal d'un organisme est modifié par l'inactivation ou l'altération de ses propres gènes ou par l'introduction d'autres gènes, naturels ou artificiels. Une application bien connue du génie génétique est la production de produits naturels (du corps humain en particulier, comme l'insuline humaine) par des organismes étrangers, qui les synthétisent en quantité suffisante pour en permettre un usage thérapeutique, après que la séquence des gènes correspondants a été placée dans l'organisme de production (souvent des bactéries ou des levures). Les produits pharmaceutiques obtenus de cette manière sont faits pour être identiques aux produits obtenus dans les conditions naturelles. A la différence de ceux que l'on obtient par génie génétique, les médicaments traditionnels sont produits par des procédés de chimie organique ou extraits d'animaux ou de plantes, et ils sont souvent moins bien adaptés à leur hôte humain (quand il ne s'agit pas, bien sûr, des mêmes molécules: la chimie et la biologie peuvent aussi produire évidemment exactement les mêmes objets). Cela peut conduire à des effets secondaires limitant l'efficacité du médicament. Ces produits obtenus par génie génétique sont habituellement des protéines qui ont un effet physiologique bien défini (hormone de croissance humaine, insuline, facteur de croissance des globules rouges: EPO bien connu dans les affaires de dopage...). On les préfère aux produits artificiels parce qu'ils entraînent moins d'effets indésirables. C'est le cas, par exemple, de l'insuline humaine utilisée par les patients diabétiques et produite par des bactéries ou des levures, qui est mieux tolérée que l'insuline isolée du porc (légèrement différente, en fait, de l'insuline humaine). L'intérêt de ce type de production est qu'il évite la contamination par des agents pathogènes pré-adaptés à l'Homme, comme on l'a vu hélas, dans la production d'hormone de croissance à partir d'hypophyses humaines.
Pour obtenir ces produits les chercheurs utilisent des techniques de recombinaison de l'ADN pour introduire sous la forme de fragments d'ADN, dans des bactéries, des levures ou des cellules animales en culture l'information nécessaire pour produire la protéine humaine qui a l'effet thérapeutique désiré. Cela est réalisé en isolant l'ADN et en identifiant la séquence du gène auquel on s'intéresse, en le clonant (c'est-à-dire en l'obtenant en grande quantité à partir de cellules appropriées) ou en en faisant la synthèse chimique, puis en le replaçant dans les cellules en culture au moyen d'un procédé biochimique du type "couper/coller" qui permet à volonté d'introduire ou de modifier l'ADN dans une cellule.
Par génie génétique, on peut obtenir des cellules reprogrammées en grande quantité, souvent au moyen de la technique de fermentation. Les cellules modifiées par génie génétique vont ainsi produire la protéine intéressante en quantité importante. Cette protéine "recombinante" sera retrouvée au sein même des cellules ou dans le milieu environnant, en fonction de la façon dont la cellule a été modifiée par génie génétique. Elle est ensuite extraite et utilisée comme médicament ou pour tout autre usage industriel. Il est important de remarquer que l'utilisation de bactéries pour produire des protéines humaines est souvent bien plus sûre que l'usage de cellules animales. En effet il n'est pas besoin dans leur cas d'utiliser de milieux complexes, contenant par exemple du serum animal, dont on sait qu'il peut être contaminé par les prions, agents de la maladie de la vache folle: la fabrication d'hormone de croissance humaine gagne donc ainsi beaucoup à être produite par des Organismes Génétiquement Modifiés.

blue Qu'est-ce qu'une cible pharmacologique ?
La vie est definie par plusieurs processus, et en particulies par le métabolisme (flux continu de transformations moléculaires) et la compartimentation (la cellule définit un milieu intérieur et un extérieur). Cela signifie que des molécules sont constamment transformées à l'intérieur des cellules, certaines sont construites alors que d'autres sont détruites, créant à la fois l'énergie et les matériaux nécessaires à la construction de l'organisme. Un poison est une molécule qui interfère avec l'un de ces processus. Un médicament est une catégorie particulière de poisons destiné à interférer seulement avec ale métabolisme d'un ensemble particulier de cellules, qui peuvent être des cellules du patient (par exemple des cellules tumorales) ou des microbes. Cette interférence, qui interrompt un chemin particulier du métabolisme, est ce qui donne sa spécificité au médicament. Il joue son rôle là ou il peut interagir avec un objet particulier - habituellement une enzyme, un récepteur ou un complex enzymatique - nécessaire au métabolisme de la cellule. Une cible médicamenteuse est un sous-ensemble particulier de tels lieux, choisis parce qu'agir en cet endroit sera à la fois efficace pour altérer le métabolisme de la cellule cible, et relativement inoffensif pour l'hôte. La situation la plus répandue et efficace est celle des microbes pathogènes. Dans leur cas en effet, le métabolisme est souvent si différent de celui de l'Homme ou des animaux que beaucoup d'enzymes existent qui n'ont pas d'homologue chez ces derniers, alors qu'elles sont essentielles pour que le microbe se multiplie et survive. C'est la base du fonctionnement de la plupart des antibiotiques. Par exemple, les molécules de la famille de la pénicilline interagissent avec des enzymes essentielles pour la construction de l'enveloppe cellulaire du microbe, si bien que le microbe ne pourra survivre dans les fluides corporels. Cette famille d'enzymes n'existe pas chez l'Homme. C'est pourquoi les antibiotiques de cette famille ont eu autant de succès et se sont si rapidement répandus. Clairement la situation est bien plus difficile avec les cellules cancéreuses, parce que ces cellules, étant des cellules du patient, ne sont pas très différentes des cellules normales. C'est pourquoi les médicaments anticancéreux sont extrêmement toxiques et dangereux, et demandent des protocoles d'usage particulièrement délicats (chimiothérapie). Heureusement ces protocoles deviennent de plus en plus efficaces au fur et à mesure que les chercheurs découvrent de meilleures façons de délivrer les médicaments, et identifient des médicaments mieux adaptés à leur cible. Comme on peut le comprendre, un médicament cible est un objet biologique spécifique qui a été étudié dans un contexte bien particulier, de façon à être choisi pour altérer le moins possible les conditions normales de la vie du patient. En fait il n'existe pas beaucoup de médicaments cibles possibles, précisément parce que la vie est si remarquablement semblable d'une espèce à l'autre (cela peut sembler bizarre, mais c'est ainsi, et c'est d'ailleurs la raison pour laquelle il est possible de synthétiser des protéines humaines dans des bactéries, par exemple). Aujourd'hui il n'existe probablement pas plus de cent cinquante cibles plausibles, avec le savoir dont nous disposons. Pourtant de nouveaux concepts sont en train d'émerger, imaginant que nous n'utiliserons plus des cibles isolées, mais plutôt plusieurs simultanément, chacune étant, si on la considère isolément, tout à fait sans effet. Un autre nouveau concept intéressant consiste non plus à empoisonner la cellule cible, mais à la rendre inoffensive, soit parce qu'elle va se conformer à son environnement (transformant une tumeur cancéreuse en tumeur bénigne) soit parce qu'elle interagira mal avec les tissus (par exemple les bactéries pathogènes ne pourront plus interagir avec un epithelium si on leur apporte des nutriments appropriés). Ce dernier concept est bien adapté à la vision populaire que se nourrir bien peut avoir un rôle important dans la prévention des maladies.

blue Comment émergent de nouvelles maladies ?
On pourrait croire, parce qu'elle est si fréquente, que la grippe ordinaire n'est pas une maladie dangereuse. Il n'en est rien. C'est l'une des maladies qui tue le plus de personnes dans le monde. In 1919, elle a ainsi tué des dizaines de millions de personnes, dans le monde entier. Depuis lors, les autorité médicales s'inquiètent de la possible, et même probable, réapparition d'une épidémie de ce type. Il est peu probable que le variant de 1919 soit aussi dangereux qu'alors, car ses descendants sont encore très présents dans les épidémies saisonnières. Mais d'autres variants peuvent apparaître. Pour cette raison un réseau de surveillance a été établi par l'Organisation Mondiale de la Santé, reposant sur la contribution de nombreux centres de recherche dans le monde (y compris l'Institut Pasteur à Paris). A Hong Kong, le Dr WL Lim du Queen Mary Hospital a fort heureusement isolé en 1997 le mutant H5N1 du virus de la grippe, qui était déjà connu pour se répandre chez la volaille, déclenchant une série de mesures qui ont empêché l'extension de cette terrible maladie. On peut dire que cette réaction rapide et l'action du Gouvernement de Hong Kong ont sauvé la vie de milliers, sinon de millions de personnes en Chine (et probablement aussi ailleurs dans le monde). Depuis 2002 les épidémies récurrentes de cette grippe du poulet rendent de plus en plus probable, hélas, l'apparition d'une épidémie majeure.
Le but réel de tout organisme vivant est d'occuper une place sur Terre (son biotope). Une façon de le faire est de se multiplier et, soit de se débarrasser des autres organismes, soit de coopérer avec eux. Le corps humain est un biotope intéressant, puisqu'il est pourvu régulièrement en nourriture, se trouve à une température plus ou moins constante, et est bien protégé contre les vicissitudes de l'environnement. Pour cette raison le corps humain (les plantes et les autres animaux aussi), est envahi par une variété d'organismes qui y survivent. De fait, nous abritons dans notre tube digestif (pour ne rien dire de la surface de notre peau) un très grand nombre de microbes (en fait, la situation normale est que nous abritons plus de dix fois plus de microbes que le nombre de nos propres cellules!). Normalement, ces hôtes sont inoffensifs, et même bénéfiques (ils fabriquent des nutriments qu'on trouve rarement dans la nourriture). Mais, occasionnellement, certains deviennent invasifs et causent des maladies. Un équilibre fin entre notre système immunitaire (qui les tient à distance) et leurs propriétés de virulence nous protège habituellement contre les maladies. Pourtant, de temps en temps, les microbes peuvent acquérir un comportement pathogène et se multiplier de façon incontrôlée. S'ils le peuvent, une fois qu'ils ont infecté une personne, ils peuvent se propager de personne à personne. Cela nous dit immédiatement que le contact entre les personnes ou entre les personnes et les animaux est importante pour la manifestation des maladies. Ce contact peut être direct (contact par la peau, boucherie, aérosols...) ou indirect (nécessitant un vecteur intermédiaire, comme la puce, le poux, une mouche ou un moustique).
Il est par conséquent évident que le comportement humain est à l'origine de maladies (ré)émergentes pdf. La tuberculose, très probablement, est apparue quand les hommes ont domestiqué la vache (c'est une maladie des bovins). La grippe, qui est une maladie des oiseaux, habituellement inoffensive pour eux, se transmet souvent d'abord aux cochons, puis à l'Homme. Et elle a habituellement son origine en Chine, où depuis longtemps les paysans ont eu l'habitude d'élever les porcs et les canards plus ou moins ensemble. La maladie, bien que très contagieuse (par aérosol), ne s'est pas propagée considérablement, jusqu'à ce que les grandes villes ou d'importantes concentrations humaines ont conduit à la propager comme le feu. Le SIDA est une maladie très peu contagieuse (sauf par contact direct du sang), qui aurait dû rester là où elle existait, probablement chez les grands singes. Mais la pratique de la boucherie de "viande de brousse" a conduit à l'infection des humains (certaines personnes mangent de la viande de singes anthropomorphes). Elle ne se répandit pas encore, jusqu'à ce que le comportement humain eut profondément changé, détruisant les règles de comportement ancestrales, et introduisant à la fois un usage fréquent du sang et de ses dérivés, l'usage des aiguilles et une promiscuité sexuelle qui n'avait pas eu d'équivalent généralisé dans le passé. A ce point, on peut prédire que la destruction de la plus grande partie de la biosphère va libérer, d'une façon incontrôlée, des animaux, des vecteurs, des microbes et des virus qui, jusqu'à récemment, étaient restés confinés dans des zones étroites. Les concentrations humaines dans les villes vont favoriser l'extension rapide de toutes sortes de maladies. On peut aussi attendre que la promiscuité sexuelle qui semble envahir tous les pays va créer un nouveau biotope où des "expériences" faites en vraie grandeur par les microbes (exchange de gènes et recombinaison les uns avec les autres ) produira de nouveaux variants virulents, ou plus cachés (et donc plus dangereux, cancérigènes, par exemple)... Les maladies sont en effet très liées à la structure de nos sociétés. Il est par conséquent très important de prendre des mesures prophylactiques généralisées. Pourtant, assez curieusement, alors que cela a été fait pour la tuberculose ou la syphilis il y a cent ans, cette attitude efficace est désormais passée de mode. Plus grave, il se pourrait que les êtres humains ne réagissent pas de manière sensée aux progrès de la science (voir Nature et Artifice), et que, par exemple, les gens ne soient pas réticents devant l'usage des animaux qu'on veut utiliser pour la transplantation d'organes: cela faciliterait la construction de nouveaux virus qui pourraient alors envahir l'Humanité!

blue Y a-t-il un risque de bioterrorisme?
Ce texte a été écrit en l'an 2000, au moment de la création du Centre HKU-Pasteur, bien avant les attaques terroristes utilisant le charbon, qui montraient, hélas, combien notre monde est éloigné de ce qu'il devrait être....
Malheureusemnt, les êtres humain sont souvent enflammés par des idées fausses ou tout simplement destructrices. Et cela conduit à un comportment agressif. Tout un arsenal guerrier biologique existe depuis longtemps. Les envahisseurs espagnols de l'Amérique l'ont utilisé, et, plus récemment, il y a eu de nombreuses tentatives en Chine par les soldats Japonais. On ne peut pas, par conséquent, écarter l'idée d'un mauvais usage de la biologie comme s'il s'agissait d'un phantasme. Et pourtant, il faut bien comprendre que la guerre biologique, au contraire de toutes les autres armes employées au cours des guerres, est difficile sinon impossible à contrôler une fois qu'elle a été mise en œuvre. En particulier, des agent comme le bacille du charbon, Bacillus anthracis, qui ont été utlisés à cette fin, restent dans l'environnement durant des décennies et même des siècles. Une bombe expérimentale, mise à feu par les Britanniques sur l'Ile Gruinard au nord de l'Ecosse, et contenant des spores de B. anthracis, a conduit à la contamination de l'île pour 50 ans, et il a fallu gratter la surface de l'île sur 20 centimètres et épandres des désinfectants pour se débarrasser de la plupart des spores! Cela ne signifie pas bien sûr que ce type d'arme ne sera pas utilisé, mais c'est clairement un très mauvais moyen de faire la guerre. Notez ici les symptômes du charbon.
Pouvons nous faire confiance à la raison humaine? Pour aller contre les usages déments que nous pouvons faire de la science il est certainement nécessaire de contrôler autant que possible l'information disponible sur ces méthodes, et nous interdire de la répandre charbon. Clairement, liberté ne veut jamais dire liberté de tuer. La désinformation est une autre possibilité, mais elle est difficile à contrôler.

blue Comment est née la vie sur Terre ?
Voir ici une série de pages où le sujet est détaillé.

blue Comment les chercheurs font-ils des découvertes ?
(pour une discussion voir la méthode critique générative )


chambord