Vaccination and COVID-19 in 2021
To display daily news, click on the triangles, or click on "Show all news". To go back go to the site Home page, or to the site map.
Show all news | Titles only
2021
| 23 December 2021. Attenuation
of SARS-CoV-2 is likely to be on its way. Since the onset of COVID-19 it could be anticipated that the virus would, at some point, evolve towards a contagious attenuated form. This was indeed discussed at the French Academy of Sciences, and is visible in a video that, for some obscure reason, is not available in a straightforward way. If you listen to the topic discussed from 1h12 min to 1h28 minutes, you will see (in French) that this was a clear anticipation, that suggested that looking for attenuated variants should be essential. It is likely that this type of censorship, also extended in the putting aside of the community of veterinaries in France, explains why we got such a poor management of the disease. In particular, while we had an extremely efficient effort meant to identify the virus in waste water (Obepine), the support by French Health Authorities has been discontinued! This is the more unfortunate because it is known that coronaviruses oscillate between lung and gut tropism (this is demonstrated by a series of epidemics in pigs since the 1980s) and that the moment when the tropism changes the disease may become extremely severe. |
|||
| 20 December 2021. The
omicron variant of SARS-CoV-2 spreads rapidly in the bronchial
tubes. Work by the School of Public Health at the Faculty of Medicine of the University of Hong Kong established that variant omicron spreads some 70 times faster than its delta counterpart in the bronchi of patients. In contrast, it is significantly slower than delta deep in the lung. This explains why the virus is so contagious, and possibly why it is causing a milder disease. This latter observation must be taken with caution because the very fact that it infects many more people will result, despite its more benign nature, in a large number of deaths. Also it is possible that it will infect a number of people who had already been infected by previous variants. This reminds us with the situation with the influenza virus, where you can be infected year after year, as the virus evolves. |
|||
| 13 December 2021. A
likely turning point when variant omicron will replace variant
delta. We can already see the beneficial effect on vaccination on the mortality rate due to variant delta: the death curve has levelled off. |
|||
| 10 December 2021. SARS-CoV-2
is likely on its way to attenuation. The delta variant of the virus invaded Japan, as it has in other countries around the whole world. However, after a period of rapid increase in the rate of infection of people, reaching a daily count of nearly 26,000 nationwide, infections with COVID-19 have since plummeted, dropping to below 200 in recent weeks. The population is largely vaccinated, as in other countries where there has not been such a drop in infections. This appears to be parallel to a series of mutation in the virus' error correcting gene, nsp14, causing the offspring of these viruses to mutate much more rapidly than their parents. It is still too early to be sure that this leads to attenuated strains that would function as a natural vaccine, but this hypothesis should be seriously considered. If validated, then the disease might gradually tend to disappear and be replaced by a mild cold-like illness. Remember that laboratory accidents are the rule, not the exception. A mouse infected by COVID-19 bit a scientists in Taiwan, and transmitted the disease. |
|||
| 6 December 2021. The
United Nations proclaim 2022 as the International Year of
Basic Sciences for Sustainable Development. The UN resolution 76/A/L.12 ‘invites all [its] Member States, organizations of the United Nations system and other global, regional and subregional organizations, as well as other relevant stakeholders, including academia, civil society, inter alia, international and national non- governmental organizations, individuals and the private sector, to observe and raise awareness of the importance of basic sciences for sustainable development, in accordance with national priorities' IYBSSD2022. |
|||
| 3 December 2021. The
SARS-CoV-2 omicron variant is extremely contagious. Prof KY Yuen of the University of Hong Kong identified a pair of patients infected with the omicron variant. Both stayed in the same hotel and used the same corridor, but separately (they were not together at the same time in the corridor) and it seems established that the contagion came from the aerosols of the first patient, which remained long enough in the corridor to contaminate the second. This observation is consistent with the explosion of cases in South Africa, where the variant has apparently emerged. Because it harbours many mutations in its spike protein, some are tempted to think that it has increased virulence (this is in line with the "the more one has the more dangerous it is" misleading heuristic) but it could, instead, show that the virus is on the road to attenuation. Its high contagion potential would make it a natural vaccine. Let's hope for the best, but prepare for the worst, with a full vaccination. |
|||
| 28 November 2021. The
SARS-CoV-2 virus keeps mutating but only a few variants
spread. The so-called omicron variant of the virus, born in South Africa seems to be spreading rapidly. This follows the expected course of virus evolution. Because the evolutionary landscape of the virus has been narrowed by vaccination, the rapidly spreading viruses are expected to escape the immune response triggered by the present vaccine. In the long term it can be predicted that the rapidly propagating variants will also have an attenuated virulence. We do not know yet whether this is the case with the omicron variant. We also should be aware that, because of the considerable human polymorphism, a variant which is innocuous in the majority of people may be virulent in some. |
|||
| 8 November 2021. As
should have been expected for a long time, a mutation in the
nucleocapsid protein of SARS-CoV-2 is a cause of its increased
infectivity. SARS-CoV-2 encodes at least 26 proteins, and it was somewhat surprising that the focus was only on its spike protein. It is now clear that one of the causes of the increased virulence of the delta variant is due to a mutation in the nucleocapsid protein with an arginine residue replaced by a methionine at position 203, just after two glycosylation sites. Methionine is known to act as an "oil drop" in proteins due to its long smooth side chain and this may play a role when the virus connects to the lipid endoplasmic reticulum of the host cell. |
|||
| 30 October 2021. A
plausible additional cause of the new wave of COVID-19:
Vaccination is essential even after previous infection by
SARS-CoV-2. In comparing, among hospitalized people, unvaccinated persons who were infected 90 to 179 days after a previous infection compared with those who were vaccinated 90 to 179 days before their COVID infection, researchers of the CDC in the USA found the incidence of infection to be 5 times higher in the unvaccinated than in the vaccinated persons. This implies that by letting previously infected people to go on unvaccinated, the open reservoir for the virus in larger than expected, contributing to the spread of new variants. |
|||
| 29 October 2021. World-wide
trade creates new opportunities for pathogens: two persons
died from meloidosis in the USA after using an India spray
used for 'aromatherapy'. Meloidosis is a very severe disease caused by the bacterium Burkholderia pseudomallei. This rare disease usually affects farmers working in rice paddies in South East Asia and India. This organism is so dangerous that it belongs to the list of potential bioweapons. On the front of COVID-19, as reported everywhere, the world is facing yet another wave of infections. |
|||
| 2 October 2021.
Beware of mutagenesis: molnupiravir has
the potential to be both mutagenic and carcinogenic. For some reason the positive effect of molnupiravir on the development of COVID-19 is highly mediated. It is important to remember that N4-hydroxycytosine derivatives are highly mutagenic if they enter the phosphorylated nucleotide pool. It is expected that this will indeed cause rapid mutation of SARS-CoV-2, resulting in weakened progeny, but the same cause will also interfere with host DNA synthesis, via the likely reduction of the modified base diphosphate to a deoxyribo analogue. The base equilibrates with a tautomeric form that binds to A rather than G. |
|||
| 20 September 2021. The
receptor binding domain of bat viruses found in Laos closest
known ancestors to pandemic strain. Scientists from Institut Pasteur of Laos, founded by Pr Paul Brey, and with limited support from the Institut Pasteur in Paris, and the National University of Laos collected samples in the Southeast Asian nation over six months from July last year. They found that the sequence of the receptor binding domain of the spike protein has features that were missing from the RatG13 closest relative of SARS-CoV-2. However the rest of the virus genome is more distant from the epidemic strain. This argues for events involving recombination between different virus strains. This type of event could as well have happened in the wild or in a laboratory setting. |
|||
| 12 September 2021. Data
from the USA allow identification of all deaths caused by
COVID-19 in this country. The American National Center for Health Statistics has released results of surveillance of mortality caused by pulmonary diseases since 2017. This allows comparison of recent influenza deaths with deaths directly attributed to COVID-19. The red line indicates that all deaths caused by lung disease are often significantly in greater number than deaths directly attributed to the pandemic, demonstrating that the official count of deaths as due to COVID-19 is underestimated even in a country as developed as the USA.. |
|||
| 8 September 2021. The
spread of COVID-19 is extremely contrasted. So far, the overall number of people affected by COVID-19 seems to be decreasing worldwide. However, some regions, such as Singapore, are experiencing a sharp increase in the number of cases: 347 new local cases of Covid-19, a figure that has not been reached there since August 2020. Other countries such as Sweden and Japan are about to relax rules to contain the epidemic. China maintains its zero Covid policy, with 14 days of mandatory quarantine even for fully vaccinated people coming from abroad. |
|||
| 3 September 2021. Exploring
the origin of the H1N1 influenza virus from the 2009 epidemic
should provide lessons for the origin of the current COVID-19
epidemic. In 2009, an alarming outbreak caused by a variant of the H1N1 influenza virus began in the United States. Early on, the origin of the variant was thought to be in China, as reported by scientists in Hong Kong. It took a long time for US researchers to discover that the virus actually originated in Mexico, after reassorting several of its eight genome pieces with viruses from Europe and Asia. The key to the reassortment was that several viruses could be found in pig farms. People were infected by pigs, and pigs infected people, in different breeding centres around the world and this allowed the presence of several viruses in a same breeding facility. The current genome structure of SARS-CoV-2 clearly indicates an origin in bats, but the transition to humans would require the simultaneous presence of several viruses in a crowded environment of possible intermediate hosts. The situations in which this might occur are not so numerous and dense animal breeding facilities, particularly if they may have come into contact with bats or bat handlers, should be targeted first as possible candidates to try to identify the parents of the virus. |
|||
| 24 August 2021. The
« danger model » of the immune response is vindicated: it
explains why children are usually a mild form of COVID-19. Immediately after birth all newborns face a permanent contact with respiratory aggression. Their respiratory system, down from the nose to deep in the lungs must be in constant alert to react against any incoming pathogen. Polly Matzinger proposed that injured cell membranes released components that were signalling danger and that, very early on during evolution, cells were prepared to react with building up a protective response, via a network of specialized cells and molecules. This « danger model » was at the origin of the immune system. Comparing the gene expression level in nasal cells from children and adult, Irina Lehmann and her colleagues, at the Charité Hospital in Berlin, have now shown that nasal cells pattern recognition receptors are expressed at a constant medium level in children, in contrast to the situation in adults. This allows these cells to trigger the antiviral interferon response very early on and thus ensure a more efficient protection. This group had already shown, last year, that the severity of the disease was correlated with the level of activation of certain immune cells in the airways. This allows triggering a protective response very early on. |
|||
| 12 August 2021. An
unexpected consequence of CRISPR genome manipulation: «
chromothripsis ». A group of scientists observed that, in a small proportion of the descent of animal cells that had been modified using the CRISPR genome editing techniques, the chromosomes had been rearranged in bits and pieces glued together in a haphazard way (caveat: this is published in the magazine Nature, hence should be taken with a grain of salt). This breakdown of chromosomes (we should commend the authors for having coined a neologism following the proper rules of scientific nomenclature) is usually letal for cells but some survive and are no longer able to multiply in a controlled way, generating tumors. Understanding this event is critical for future developments of the technique if it is applied for gene therapy, for example. Australia and China struggle to implement their zero COVID policy, with more than 70,000 party members sent to help cities in China, while more army personnel is deployed in Australia. A high profile member of the Chinese Centers for Disease Control has now argued that the only way out is massive vaccination, and that a zero COVID policy will be impossible to sustain in the long time. |
|||
| 30 July 2021. The
« zero COVID » strategy is almost
impossible to implement. At a time when the Nanjing episode has now spread to multiple provinces in China, Australia sending in its army to enforce lockdown in Sydney. This is interesting because the same goal is is chosen by two diametrically opposed political systems. We can safely predict that « zero COVID » will not succeed. While this was possible at the onset of the disease, this is now a fantasy. The only way out is vaccination, with continuous research to create vaccines that keep adapting to the evolution of the virus. The alternative, discovery of efficacious antivirals, would match the success of antibiotics, but, because viruses entirely depend on their host cells, this is probably as difficult as curing cancer. In any event vaccines and antivirals should go hand in hand, as do vaccines and antibiotics. |
|||
| l |
27 July 2021. A
significant cluster of SARS-CoV-2 variant delta is affecting
Nanjing in China. It will be interesting to see how this small outbreak—now 106 cases—develops as China still attempts to implement a "zero COVID" policy. This outbreak was initiated by aircraft cabin cleaners who were asymptomatic, and spread rapidly. People who transited in Nanjing airport are spreading the virus to several provinces. Dong Yan Jin at the University of Hong Kong suggests that people at higher risk, such as medical and airport personnel should be given a third vaccine injection, as this induces a very strong immune response and prevents contamination. |
||
| 21 July 2021. People
who refuse to be vaccinated are guilty of reckless homicide.
They should be severely punished as such. Vaccination is known for more than two centuries as an efficient way to stop the propagation of epidemics. It allowed mankind to get rid of small pox and, recently, of poliomyelitis. It also prevents millions of premature deaths and disease harmful sequels for many diseases. There is no excuse for refusing to be vaccinated against SARS-CoV-2. In fact the present surge of the pandemic should have been contained if more people had been vaccinated. Furthermore, the very fact that there is a large number of non vaccinated people makes that the virus keeps multiplying variants, many of which are, and will be variants of concern. If dangerous variants emerge, in particular affecting young people, this will be the consequence of the irrresponsible behaviour of those who refuse vaccination, as well as of governments that fail to implement a compulsory vaccination policy. |
|||
| 6 July 2021. The
Lambda SARS-CoV-2 variant has reached Australia. Originating from Peru in december 2020 this variant is now the source of more than 80% of COVID-19 infections there. It is also widespread in Chile, Ecuador and Argentina. It has a mutation in the spike protein called L452Q, similar to the L452R mutation seen in the Delta and Epsilon variants. This is a variant of concern not only because it spreads fast, but because it appears to be more resistant to vaccines. |
|||
| 2 July 2021. Dangerous
gain-of-function experiments keep being developed with
virulent viruses. Charles Perrow, in his Normal Accidents, has given a vivid demonstration of the inevitability of accidents in high technology developments. Viruses are particularly prone to propagate within laboratories and then become widespread. This is why extreme confinement rules such as BSL-4 laboratories have been created. Yet, before being restricted to such premises a virus must have been recognized as belonging to highly pathogenic microbes and toxins. This is not the case of SARS-CoV-2, for example (and, indeed, it is free in the wild, as we keep noticing, especially with the propagation of the delta variant). Some influenza viruses belong to the list but much experiments are developed with limited rules of confinement. In particular, both for SARS and flu viruses experiments of « gain-of-function » have been are are still performed on a regular basis. This means that scientists use a virus that infects animals of a given species, to see how they could evolve to infect another species, man included! A recent experiment of this family has explored how the influenza virus H10N7 could spread between mammals. This virus is infecting seals, and the authors of the study, showed how it could spread to ferrets (a model systematically used a mimicking human infections) via air. Remarkably, this study showed that the mutations that changed host specificity were the same as some found in the highly pathogenic H2 variant of influenza. Besides the highly controversial implementation of this family of experiments, this demonstrates two things: 1/ there are multiple paths to go to H2-like forms of the virus, and this indicates that we should monitor extremely carefully the possible resurgence of the H2N2 flu, for which only the oldest part of humanity may still have antibodies (it can be predicted that its consequences will be catastrophic, especially for young people), and 2/ that we should monitor flu viruses that have already spread in mammals. This is the case of the dog flu virus H3N8, which also infects horses and seals, suggesting that it is only a few steps from infecting man. Unfortunately, people seem to become amnesic each time an epidemic is vanishing, and never prepare for the future... |
|||
| 25 June 2021. Wonder
about laboratory accidents? Visit microbiology laboratories
and see by yourself. Implementation of biosafety rules is compulsory. Yet, are they enforced? Just visit a microbiology laboratory and see how many scientists, engineers and technicians wear a lab coat. With the present day dictatorship of the ego, not difficult to see that people do what they wish, not what they should do. This very unfortunate behaviour is a plague worldwide and demonstrates a complete lack of understanding of a considerable number of laboratory personnel, especially in university settings (in industry, because of norms imposed by insurances, with important financial consequences in case of defaut, biosafety compliance is much better). lack of understanding of the deep nature of freedom, which cares for what happens to other people than the omnipresent ego is also the major cause of the slowing rate of vaccination. |
|||
| 14 June 2021. The
epidemic is on its way for a new wave in UK. The delta variant has gained in UK, triggering a new wave of the disease. Despite an excellent level of vaccination UK is on its way for yet another wave of COVID-19. This is because its transmission is significantly higher than that of previous variants, with the consequence that herd immunity will require that at least 80% of the population is vaccinated before the disease can be under control. Vaccination should be compulsory. |
|||
| 13 June 2021. The
delta variant of SARS-CoV-2 is likely to spread worldwide and
trigger yet another COVID-19 wave. The delta variant, coming from India is progressing in UK. It is both more transmissible and possibly cause of a more severe disease. Its spread must be contained as much as possible while the vaccination campaign is upgraded. |
|||
| 10 June 2021. Aedes
egypti mosquitoes
infected by the intracellular
Wolbachia bacteria suppress spread of dengue fever. A trial in Yogyakarta in Indonesia demonstrated that sectors spread with the wild type mosquito Aedes egypti had considerable more cases of dengue fever than sectors where the mosquito had been infected with Wolbachia bacteria, which it spread efficiently to its progeny. This raises hope to control and possibly eradicate dengue fever in the many regions where the disease is now on the rise. |
|||
| 5 June 2021. Pending
acceptation by a peer reviewed journal the « final unknown »
of the human genome has finally been sequenced by the «
Telomere 2 Telomere Consortium ». While it has long been said that we knew the complete sequence of the human genome some 8% was still unknown. Thanks to techniques allowing long reads (PacBio and Oxford Nanopore) this is now completed. Using an embryo tumor with an exact counterpart of a duplication of the 23 chromosomes of a human organism it has now been possible to sequence highly repeated regions such as those of the chromosomes' centromeres, bundles of DNA that hold the chromosomes together and play a key role in cell division. Because these sequences are highly repeated they generally do not code for protein genes. Yet, this allowed identification of approximately 80 new genes, the function of which being a matter of speculation at this time. |
|||
| 1 June 2021. A
study developed by the Butantã Institute in São Paulo
establishes the herd immunity when the population is
vaccinated using the Chinese Coronavac vaccine. The study, that was initiated 40 days ago in the small city of Serrana (45,000 inhabitants), shows that when 75% of the population has been vaccinated using the Sinovac's lead vaccine against SARS-CoV-2 the epidemic of COVID-19 stops developing. |
|||
| 29 May 2021. Vietnam
health authorities have identified a new SARS-CoV-2 variant
spreading extremely fast. This variant appears to be a hybrid combining the UK and the India variants. This is not unexpected as natural selection will favour spread of the virus. However its pathogenicity is not established at this point. If it is less dangerous than its parents, then it might spread and act as a natural vaccine, as happened previously in animals with various coronaviruses. |
|||
| 23 May 2021. COVID-19
patients treated by steroids are at risk of catching dangerous
secondary infections. With the large number of patients in India some concerning trends are observed when patients begin to recover from COVID-19. In particular those treated with steroids are at risk of catching mucormycosis, an infection caused by a very dangerous fungus of the genus Mucor (black fungus). India recorded already more than 9,000 cases of this infection with a mortality rate of 50%. |
|||
| 16 May 2021. In
the many errors the WHO made and that spurred the pandemic is
lack of understanding the role of aerosols. On April 30, the WHO updated a page on its website. Wired reports that in the section describing coronavirus transmission, the text now states that the virus can spread via aerosols as well as larger droplets. It was easy to miss this major change the importance of which has a considerable role in the spread of the epidemic. This failure, not pointed out by relevant ministries and agencies, advocates for major changes at the level of health authorities, world-wide. Singapore authorities, facing a sudden resurgence of the disease, note that the Indian variant, B.1.617 may have a higher propensity to affect children and possibly young people than the original strains. They have decided to close schools. |
|||
| 15 May 2021. There
is no scientific justification for « gain of function »
experiments. Twenty years ago we argued against the idea to sequence the small pox virus genome. We argued that the corresponding knowledge had no value for the common good. In fact this type of knowledge triggered experiments of « gain of function » where a mild pathogen could be made to evolve into a very dangerous one. For reasons that are of no moral value scientists, world wide, kept developing this type of experiments, and there are now reasons to suspect that such dangerous attempts were developed at the Wuhan Institute of Virology, sponsored not only by China, but by the USA and other countries. Remarkably, a number of experiments belonging to this family of forced evolution approaches keep being developed. |
|||
| 8 May 2021. Public
policy imposing rules for the common good is considerably more
successful than let do policies. It is more than time to assess the consequences of government policies at a moment when the majority of countries affected by the disease still prefer to live with COVID-19 rather than fight it seriously. A publication in The Lancet sheds light on the consequences of various politicies. By all criteria (including the length of restricting public freedom), it seems that aiming at a "zero COVID" goal is by far the most successful policy, not only in terms of economic recovery but also in terms of the length of freedom restrictions. Once again, following the unfortunately widespread dictatorship of the prevalent ego-centered rule that prevails in the major part of the world, a rule that tends to let people do more or less as they wish, has considerably negative consequences for everybody. Controlling COVID-19's development immediately as it appears (with strict confinement rules implementing significant penalties when people do not comply) is extremely efficient because it allows fast return to normal, both in economic terms and in terms of freedom. Excess mortality is still visible in France at this time. |
|||
| 5 May 2021. The
seasonality of COVID-19 seems to hold again. A variety of studies have suggested that COVID-19, as other respiratory diseases, is likely to be seasonal. This gives hope for the next few months (provided vaccination is properly enforced). Among the various factors involved, in particular temperature, humidity and UV light, only the latter seems to have a real effect, for reasons that are not entirely clear. It is however important to remember that low temperature means that people tend to group together in confined spaces, which is the most evident source of contamination. The demographic explosion is therefore a major cause of dangerous epidemics. In this respect, and contrary to the "natalist" stance held almost everywhere, China will probably be the first to solve the problem. It is a fiction to state that a country full of young people will survive better than a counterpart with old people: the first decades of life are as costly for economy as the last ones are, and while youth is indeed innovative, it can only be so if the memory of what has been previously established is preserved. This is why highly evolved civilizations suddenly disappeared, and it took centuries to find back what was previously known. Innovation can always reinvent the wheel. |
|||
| 30 April 2021.
Extremely rare accidents related to
vaccination should not be used against this essential way to
control the COVID-19 epidemic. All human practices entail some level of risk. Domestic accidents, for example, are unfortunately quite frequent and we all know that driving a car can be deadly. Yet we do not refrain to use this transportation means. In the case of vaccination, which implies injecting a foreign entity in the body, it is expected that, for some people, this will trigger an adverse reaction, sometimes deadly. In contrast, this will protect people and avoid the dire consequences of a bad COVID-19 infection. It is therefore essential to compare the benefits of vaccination against the risks that people face when they are not vaccinated. A study involving more than 600,000 persons in the United Kingdom has measured the adverse effects of two vaccines, the BioNTech/Pfizer vaccine and the AstraZeneca vaccine. The outcome of the analysis is important. It demonstrates that side effects are generally of minor concern and that accidents related to the vaccines are extremely rare, so that there is an overwhelming benefit for people in being vaccinated. An observation, however, needs to be carefully monitored as the epidemic unfolds: people with a previous COVID-19 diagnosis were three times more likely than others to have systemic side effects after the first BioNTech/Pfizer dose, nearly twice as likely after an AstraZeneca dose, and were more likely to report local side effects. This indicates that in the future, some variants of the virus might trigger paradoxical responses, with previous infections (and possibly vaccination) leading to sensitization in parallel with alteration of protection. It is nevertheless critical to understand that the common good should prevail on individual interests, in contrast with the present dictatorship of the ego which prevails in the Western world. |
|||
| 28 April 2021. Another
perspective: the death rate in France is ten times worse than
in India. At this time, the official figures of the Indian Health authorities count 147 deaths due to COVID-19 per million citizens. The figure in France is 1,584 per million. However there is a steep increase in India, when the curve is flat in France, but this leaves time for India to get figures as bad as those in France. In parallel Canada has developed an excellent system to identify new variants of the virus, with a central system for reporting SARS-CoV-2 sequences. It is important to highlight the fact that, as a matter of principle, all nucleotide sequences should go to the International Nucleotide Sequence Database Collaboration (DDBJ/ENA-EBI/GenBank), but that, for obscure and unspeakable reasons, many virologists do not comply with this requirement. In France the inept authorities that supported failed quack doctors remedies are totally unable to follow what is happening. Unfortunately, this does not have anything to do with political orientations as the political personnel there, left, center and right, is totally scientifically illiterate. This implies that France will soon vanish from the important countries and will see its health system collapsing. |
|||
| 20 April 2021. COVID-19
in perspective. While the disease has killed more than 3 million persons, it may be remembered that tuberculosis still kills 1.5 million people every year. |
|||
| 13 April 2021. A
small peak of mortality in Europe affecting people younger
than 45 years should be a matter of concern. Half the number of severely affected people in Brazil are younger than 45 years old. A small peak in Europe reveals a similar tendency, that shows that the disease should be taken very seriously by young people. |
|||
| 11 April 2021. The
present demographic explosion is much more worrying than
COVID-19. Our planet is now occupied by 6 billion more people than one century ago. This is not sustainable even in the fairly short term. This is so obvious that it seems that the vast majority of us is completely blind to the difficult moments that lie ahead of us. |
|||
| 9 April 2021. Further
confirmation of the social nature of our diseases. The Federal Office of Public Health in Switzerland has collected information on contagious diseases since the onset of the COVID-19 epidemic and compared them to the previous period. In practice, measles has practically disappeared: 4 cases compared to 149 the year before (and none in 2021). The same situation prevails in France with 240 cases compared to 2636 in 2019. Similarly, there were only 117 cases of influenza in Switzerland compared to 12,441 cases in the previous 52 weeks. The same trend was observed for bacterial respiratory diseases. |
|||
| 7 April 2021. The
management of the epidemic differs considerably in different
European countries. Some countries took the lesson of their initial mismanagement and considerably improved the way they tackle the epidemic. |
|||
| 28 March 2021. The
World Health Organization has not yet published its report of
the origin of COVID-19. While the WHO team is back from China for a long time it did not release a full report of their findings. In any event, the very fact that Peter Daszak belonged to the team is unwelcome, as he was a member of a that supported research, financially and scientifically, at the Wuhan Institute of Virology, a clear conflict of interest. The question asked is the gap between the genome sequence of the bat related viruses, in particular RaTG13 and the sequence of SARS-CoV-2. In the latter, there is a very puzzling inserted sequence that allowed the virus to smoothly enter human cells via its receptor ACE-2. This implies recombination with another virus, either accidental (for example via co-infection with viruses of the same family, also found recently in South-East Asia) or constructed in a laboratory in those "gain of function" experiments that have been quite fashionable for several years now, finding their way to popular journals such as Nature or Science, a feature that is doomed to please ambitious scientists. A laboratory accident cannot be excluded at this point, in particular in Wuhan. The spread of the disease is gaining pace again. This could be expected very early on. We also must be aware now that it will become endemic, requiring frequent vaccine changes unless we discover efficient antiviral molecules. |
|||
| 21 March 2021. Our
diseases are social diseases. One month ago we could hope for the best, but this assumed that we would have prepared for the worst. This did not happen, and the epidemic is starting back again. In a planet plagued by the consequences of the human demographic explosion, it would be necessary to refrain from gregarious gatherings. Unfortunately, for all kinds of reasons people continue to forget to keep reasonable distances, and the virus propagates. It is now more than urgent to follow how the virus varies, so that we could identify places where it has become attenuated. Unfortunately it seems difficult to get proper access to the sequences of the viral genome and information is not properly shared. |
|||
| 18 March 2021. France
keeps failing to manage COVID-19 properly. The Lowy Institute provides us with a sad picture of the calamitous way the French government manages the disease. The parallel with the destruction of the education system since the mid-1970s and the virtual absence of scientific culture—and of knowledge of the French language, which is essential for structuring thought—in the French political personnel certainly explains this unfortunate situation. |
|||
| 16 March 2021. Incompetence?
Cynicism? Possibly both ? or a serious problem ? How our
governments cope with vaccination. Correlation is not causality. For any large number of people facing any medical act—or attending any event whatsoever, going to cinema, eating at a restaurant, attending a sport's event—one expects that, in the following days a significant number will pass away. For example, if we take 5 million persons, we expect that 50,000 will die within the year. Because there is 365 days in a year, this means that 137 on average will die the next day. Millions of people have been vaccinated against COVID-19—and this is excellent news—so that we expect that, following vaccination, but without any causal relationship, approximately 1,000 people will die in the following week. We can even tell something about the cause of death: for a large number of those it will be the consequence of a cardiovascular event. The only real significant side effect of vaccines that we must expect—without knowing beforehand exactly how many people will be affected, but the number will be small—is strong allergic reaction, possibly anaphylactic shock. Because the vaccination campaigns have been a complete failure, cynicism might prevail: creating panic is a way to have less candidates to be vaccinated. However, we are well aware that knowledge cannot be the result of a vote, and politicians have less knowledge and lower intelligence than those who we would prefer to see in charge. With the reported figures, it seems unlikely that vaccination is the cause of letal accidents. Even if this were the case, their number should be places in perspective: several hundred people die from COVID-19 every day in Europe, while, with the data available, the vast majority would not if they had been vaccinated. |
|||
| 15 March 2021. Let
us forget apocalyptic scenes and look at lovely pictures of
what life is like. In Hong Kong the Croucher Foundation has initiated a very interesting program for the study of biodiversity in the city. Most of us are familiar with skyscrapers and a huge human density, but Hong Kong is a nice place for observing animals and plants. At the border between the Tropics and the Palearctic region, Hong Kong is home to a huge number of life forms. Have a look at a first catalogue of what can be found there! |
|||
| 12 March 2021. An
African
swine fever outbreak in Malaysia causes concern in
China. African swine fever is a severe viral haemorrhagic disease killing pigs en masse (as much as 50 % of the swine population in China has been killed in recent outbreaks). This disease, caused by a double stranded DNA virus does not infect man. It is transmitted by ticks, but also when animals eat meat of contaminated animals and even, most likely from animal to animal. No vaccine is available at this time. The virus has been identified in a wild boar in 2020 in Germany. |
|||
| 28 February 2021. Viruses
related to SARS-CoV-2 were also discovered in a Thai drain
pipe. This establishes that the origin of the infamous virus lies in the South East region next to Yunnan province in China. Caves inhabited by bats are also explored in Laos. This information is not really novel as RaTG13 came from the same region. It still remains difficult to understand how a "furin-sensitive" cleavage site was introduced in the virus that became SARS-CoV-2, making it highly contagious. The WHO has also identified studies on the Nipah virus as a priority research topic, noting that it also causes a disease in pigs, animals that are often a relay for virus adaptation to man. |
|||
| 21 February 2021. Two
viruses found in horseshoe bats in northeastern Cambodia are
very similar to SARS-CoV-2. The sequence of the viral genome, stored in a deep freeze for more than a decade has a 92.6 per cent identity to SARS-CoV-2 behind the Covid-19 pandemics. This is less than the 96 per cent identity of the RaTG13 virus stored at the BSL-4 laboratory in Wuhan, but quite significant. As expected, some researchers interpret this finding as suggestng that SARS-CoV-2 did not escape from a lab, forgetting that some laboratories store hundreds of viruses in their collections after they have been discovered in the wild. In parallel an outbreak of COVID-19 has been indentified in 32 Chinese nationals in Cambodia, related to a night club. Again, this emphasizes the very negative role of crowded environments in the propagation of the disease and points out, again, the critical role of aerosols. |
|||
| 20 February 2021. The
COVID-19 pandemic is at a turning point. At first sight, this is good news: the overall number of cases and deaths due to the pandemic is going down significantly. |
|||
| 13 February 2021. While
the WHO envoys went to Wuhan little novel information came
out. This is unfortunately not unexpected. We have already established that because the Wuhan Institute of Virology is a BLS-4 class (the highest level of biosafety) laboratory, it is supervised by authorities that must comply to the highest level of confidentiality, classified information. This is due to rules linked to biosecurity and, naturally, the associated so-called « secret services ». Most often people do not take confidentiality rules seriously, and consider that information travelling between the relevant personnel will, one day or the other, be made public. While this happens sometimes, this is in fact seldom happening, except decades after the fact, if ever. Furthermore the way contacts between people in secret services are constructed is meant to prevent leaks, even under torture. Only minor information is leaked out, in fact. The obvious consequence, which should have been made public—this is not confidential information—is that not a single interesting fact could come out of a visit of a BSL-4 laboratory! The only way to get information is to reconstruct reliable and plausible scenarios. It is puzzling, in fact, that mass media did not really discuss these facts, nor the fact that Peter Daszak [20 Sept 2026note that the link to this information has been cancelled since the date of this text], who belonged to the visiting committee had also been among the people who financially and in practice supported research there. A few comments are provided here and there, but nothing serious. Another obvious question is the way viruses are made available to virology laboratories. How are they transported, for example? In fact, there are ways to do so in a safe way (provided there is no human interference, such as a terrorist attack for example, to get hold of the sample). Biological samples are fragile enough, so that it is fairly easy to devise self-destructive containers. Yet, one would have expected to see articles describing this. And also other open questions linked to transport, which, again, are more like what one could read in fictions such as Red Sparrow, or, more in line with the present pandemic The End of October. In a world dominated by a deluge of spurious information, the most obvious questions are not even asked. |
|||
2 February 2021. The
management of COVID-19 differs considerably between countries.
|
|||
| 27 January 2021. Because
evolution does not have design, it is myopic. We have to be careful when taking the anthropomorphic metaphore of the «point of view of a virus». What we state behind this figure must take into account whether we look at viruses in the short term or in the long term. If a virus has to have a progeny for a long time, then it has to avoid killing a large fraction of its hosts, and this entails a specific list of functions, with a variety of scenarios, depending whether the progeny of the virus is large or, on the contrary, limited. By contrast, when a new virus emerges as a pathogen, it cannot "decide" that it will exist for a long time. In the short term, it will often simply maximize its progeny. And this can be at the cost of killing its hosts. This is an important feature that must be borne in mind with the present epidemic: For some time we still may face variants that will have an increased virulence. Aerosols in confined spaces are worrying but research is developing to create aeration systems that will kill viruses, preventing contamination from person to person. This type of system, if efficient could be used in transport, restaurants and other places with an important human densisty. |
|||
| 24 January 2021. A
great many strains of the SARS-CoV-2 virus are circulating,
and due to a lack of correct sequence data, they cannot be
correctly associated to their virulence. There is no correct access to the genome sequences of the virus and much of the metadata (patient and disease characteristics) are insufficient or fanciful. Sequence producers often keep them to themselves! Here are some open questions: 1/ There is a very surprising discrepancy between the epidemic in sub-Saharan Africa (and north of South Africa) and what is happening in the USA for African-Americans. This seems to indicate an environmental effect, but it is more likely a combination of a protective genetic effect and a different sensitization. All kinds of combinations are possible. It would be good to know what we can learn from this, especially remembering that the virus is an enveloped virus, which implies an unexplored role of lipids for example, which involves genetics of course but also food : a/ Food. It differs enormously depending on the place, with extraordinarily distant food families. b/ Other infections, hygiene: idem. c/ Climate (temperature, humidity, UV...) d/ Local population density. e/ Occupations. We need a point of comparison. Can we identify Africans in the USA who have recently become Americans? A similar situation exists in metropolitan France, between inhabitants of Antilles and Africans. Is it possible to get an idea of the severity of the disease among these groups? With respect to genetics, an interesting article about people from East Asia suggests that contact with coronaviruses is very old. It should be noted that the response to a first infection with a given virus can, as we have already pointed out, sensitize for a second infection. 2/ An unusual feature of the epidemic is the sudden appearance of severity from the age of 60-65. This is quite unusual for viral diseases. In reality, in a very large number of cases, viral infections are particularly dangerous for children, including very young children. The case of influenza is a special case: it is not the disease itself that is most dangerous for the elderly, but the fact that the virus inactivates the immune defences, already somewhat diminished with age, and favours the appearance of other diseases, usually bacterial, which then become very dangerous. It then becomes important to understand what happened around 1955-1960. We may notice an epidemic that has not been repeated since, the H2N2 flu. Could it have triggered a sentisizing response in the infected population? In this regard, do we know how H2N2 spread around the world? What about Africa? It would be interesting to overlap the map with today's severity map. Of course we should not forget gut diseases. They are often relatively unnoticed, but they have changed a lot in recent years (cf "gastros", noroviruses, etc). 3/ For the spread of the epidemic, it is more than likely that the different mutants will spread differently. The most important information is the quality of the metadata. We must in fact wait for the emergence of a variant that has been attenuated or that will have changed tropism at least in the medium term. In the short term, as we have discussed, it is not impossible that the virulence will increase, before it seriously declines. 4/ Models from the point of view of the virus would be interesting. They belong to game theory, with the virus' aim of reproducing itself in such a way as to continue to exist in the long term. It will be necessary first to start by making a list of the functions necessary to ensure this constraint and see what happens. 5/ Finally, human societies must be taken into account: this is where super-spreader events come into play. |
|||
| 19 January 2021. Now
that the vaccination campaign is ongoing we need correct
evaluation of the success rate of vaccines. The various studies that were used to authorized vaccines are far from being based on correct clinical protocols. It seems unlikely that they are as successful as their producers claim. However, because a large number of persons have now been vaccinated we should be able to know what is the real success rate of the first vaccines, and correct protocols should be used in the future. Also while vaccination is obviously the best way to go at this time it seems very important to correctly identify negative side effects. In particular the Norway health authorities have some indications that very fragile persons may be negatively impacted by vaccination, including in terms of death rate, but this needs to be substantiated. |
|||
| 16 January 2021. The
pandemic potential of a virus is closely linked to its ability
to generate asymptomatic cases. Very early on, during the present pandemic, we noted that if there were a significant number of persons infected without symptoms, the epidemic would soon become out of control. While understanding this is straightforward it has not yet been understood in the case of future pandemics. For example the H5N1 influenza virus is extremely virulent, but, because it did not generate asymptomatic (or very mild) cases, the virus did not spread in the human population, despite the way it was presented early on. For this reason we should probably not be concerned with many other influenza viruses (which must be carefully monitored however), but we should contemplate the fact that H1, H2 and H3 variants are the most likely sources of future flu severe pandemics. The H3N8 virus, which infects dogs, horses and seals is unfortunately a candidate for future epidemics, and the H2N2 virus, which had created a severe pandemic in 1957-1958 might come back with a vengeance, as the corresponding immunity has probably all but disappeared in the major part of the human population. In terms of drugs we should look for chemicals that could alleviate the most severe symptoms, while leaving the virus enough room to generate an immune response in its hosts. |
|||
| 13 January 2021. SARS-CoV-2
evolves very fast to escape the adaptive immune system. A study by the laboratory of Rino Rappuoli has shown in vitro that SARS-CoV-2 could escape neutralisation by patients' antibodies after a few mutations generated during serial growth on a medium containing antibodies. The observed changes are similar to those observed recently in UK and South Africa, casting doubt on the future efficiency of the present vaccine. Besides this caveat we should note that this experiment is typically of the « gain of function » category, and this should have been developed in extremely secure environments (at least BSL-3 + level). Proper description of the relevant facilities is absent from this article, which is a serious breach of safety / security, especially because the authors of the study belong to laboratories located in Italy (Siena and Trieste), USA (La Jolla and Austin) and London (UK), which may suggest that the mutant virus has been moved around. |
|||
| 11 January 2021. The
origin of SARS-CoV-2 is likely to remain unknown. The WHO has set up a team which is now going to investigate the origin of the COVID-19 epidemic. While this looks an obvious way to go it is likely to fail to provide significant knowledge on the origin of the virus. In particular the BSL-4 laboratory in Wuhan will be at the center of the investigation, but, quite surprisingly, a member of the WHO team, while obviously an expert, belongs to an institution that provided funding to that particular laboratory! Also it is essential to understand that all BLS-4s are strictly submitted to extreme confidentiality rules, world-wide. This is because they deal with classified information, for obvious reasons—technical knowledge associated to dangerous pathogens could be used by malevolent persons or even states. It follows that information not only on specific practice but also type of experiments, and species of interest will not be freely accessible. This implies that people who will claim to be aware of what is going on in these laboratories have no reliable information whatsoever. Furthermore, the implementation of classified information in this domain entails that the life of those who would like to communicate what they know is certainly at risk. The only rational reflection we might have is to try and forbid any laboratory, anywhere, to store dangerous pathogens in the same location. Also, while it it technically possible to transport pathogens in a totally secure way, placing them in and out of transportation devices is prone to generate accidents. As usual with highly evolved technologies accidents are doomed to happen. For this reason it is not right to claim anything to be accident-free. The only rational way to go is to know how to behave after an accident has happened. |
|||
| 9 January 2021. SARS-CoV-2
is evolving fast. It becomes important to take the point of
view of the virus and explore where it is going. Functional analysis it key to understand life. This approach tries to list the expected functions for all agents involved in living processes and explores their relationships. Briefly, a particular agent has a master function which is developed into a network of helper functions, following two major types of hierarchies: dendritic (tree-like) hierarchies, and segmented (based on individually organized "organs" hierarchies. This is illustrated for example by the functions of a printer (master function: print), which requires helper functions such as power supply, ink feed, paper feed, etc. |
|||
| 4 January 2021. The
number of retracted articles on COVID-19 keeps increasing at a
fast rate. The Retraction Watch site keeps recording papers dealing with the COVID-19 epidemic that have been retracted. Unfortunately this is only the tip of the iceberg at a moment when almost 150,000 articles have been either published or placed on-line on this important topic. Among the many papers dealing with "work" coming from conspiration sites (e.g. the role of 5G or all kinds of "waves" on the epidemic) are many articles that have unfortunately considerably influenced the way authorities dealt with the epidemic, thus slowing down important discoveries that will help us tackle the disease. A prominent role there is the catastrophic use of hydroxychloroquine (unfortunately only a limited number of papers have been retracted yet), which not only jeopardized important clinical trials but was also likely to have increased the letal burden of the disease. |
|||
| 1 January 2021. A
remarkable modification of the RNA used for the
BioNTech/Pfizer SARS-CoV-2 vaccine is likely to prevent
viruses from using the human construct to open up their
evolutionary landscape. The engineers who conceived the BioNTech/Pfizer RNA anti SARS-CoV-2 vaccine had a key idea to stabilize the encapsulated decoy RNA coding for a major antigen of the virus surface, as it is notorious that RNA is a very unstable molecule, by altering its chemical setup. Luckily, this change has a second beneficial property. This modification cannot have been preset for any recombination process, so that the likeliness that part of the artificial construct gets in other viruses, allowing them to find new ways to evolve is likely to be extremely reduced. In the same way RNA-dependent polymerization into a complement will likely be more difficult. Here is the trick (summarized in an interesting study). An RNA is made of four building blocks, A, U, G and C, which have the ability to pair: A with U and G, with C. Now, the heterocyclic part of the U building block can be rotated into a different molecule named pseudouridine, ψ, which can still play the role of when the RNA is used to make proteins, but which alters in subtle ways the general transcription / replication machinery. GAAUAAACUAGUAUUCUUCUGGUCCCCACAGACUCAGAGAGAACCCGCCACC we have in the artificial construct of the vaccine: GAAΨAAACΨAGΨAΨΨCΨΨCΨGGΨCCCCACAGACΨCAGAGAGAACCCGCCACC The latter is still recognized by the machinery that will translate the "message" of the construct into the protein playing the role of the antigen, and subsequently trigger the immune response. This also increases considerably the safety of the construct. |
Go to COVID-19 turning point
Go to COVID-19 in April 2020
Go to COVID-19 in March 2020
Go to start of COVID-19